01 de abril de 2022

The Korean and Chinese species recorded as "Corbicula felnouilliana" are different.

The Korean and Chinese species recorded as "Corbicula felnouilliana" are different.

Jaehoon Kim told me that Corbicula felnouilliana from China and Corbicula felnouilliana from Korea are completely different in appearance.
So, when I drew a phylogenetic tree with the COI gene listed in the NCBI, it was confirmed that it was a completely different group.
The group previously recorded as Corbicula felnouilliana in Korea appears to be a completely different species.

The phylogenetic tree can be viewed on the page below.
https://cafe.naver.com/yangpakor/42666

DQ285578.1 Corbicula lamarckiana
TTTTAGGGTAATTATTCGAATGGAACTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCAGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATACGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
19 LCO1 D11.ab1
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNNCTATNCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
11 LCO1 D10.ab1
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATNCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGNANATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACNATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGAGCTC
12 LCO1 E10.ab1
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAANAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATNCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGNAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGAGCTC
1114 GoBook 01
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
1114 GoBook 02
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
1114 GoBook 03
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
1114 GoBook 04
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 GoBook 05
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HanGang 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HanGang 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HG 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HaeMi-A
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HaeMi-B
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 JookSung 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 JookSung 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 MoonKyeng 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 MoonKyeng 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTATTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAAAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 DJCo 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 04
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 DJCo 05
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 07
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo o1i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo o2i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo o3i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 GRCo 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 GRCo 02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 GRCo 03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 HD01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 KMRCFW222
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 NJCo 01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 NJCo 02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 NJCo 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Joonam 01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATGCTTTTGTTGGTTANATCANCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTNGAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Joonam 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Joonam 03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATANCTATGCTTTTGTTGGTTAAATCANCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Joonam 04
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Joonam 05
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTGGTTAAATCANCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTNNAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Najoo 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Najoo 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Najoo 03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Seosan 01
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATNCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTNGCANTATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Seosan 02
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGNAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Seosan 04
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCNATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTNGCANTATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Wanjoo A
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGNTATNCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTNGCANTATTGCTCATTCTGGTCCTTCGGNAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Wanjoo B
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATNCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Wanjoo C
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211240.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211241.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211242.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGAGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211243.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTCAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATACGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211244.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCCTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCCTGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCCATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTTTGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211245.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTATTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211246.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCGATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211247.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATCCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211248.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGTTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211249.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTGACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211250.1 Corbicula largillierti
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCCAGAAATATTGCTCATTCTGGCCCATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211251.1 Corbicula largillierti
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCCAGAAATATTGCTCATTCTGGCCCATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211252.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATACCTGTATTAGCTGGAGCTC
2018 KC211253.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTATTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211254.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTGTTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211255.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211256.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTACTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211257.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211258.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211259.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGTTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211260.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTGGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211261.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211262.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211263.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTTCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211264.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTTCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211265.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAATTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211266.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTTCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211267.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTTATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211268.1 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211269.1 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211270.1 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211271.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGAACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211272.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211273.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211274.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211275.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211276.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTGAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211277.1 Corbicula sandai
TTTTAGTGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCGTTAATGCTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211279.1 Corbicula sandai
TTTTAGTGTAATTATTCGAATAGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCGTTAATGCTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211280.1 Corbicula sandai
TTTTAGTGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCGTTAATGCTAAGGGCTCCTGATATGGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211281.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211282.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATATTGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCCATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211283.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211284.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTTATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211285.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTTATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAACGCCTGTGTTAGCTGGGGCTC
2018 KC211286.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211287.1 Corbicula leana
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTTATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211288.1 Corbicula leana
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211289.1 Corbicula leana
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCCGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCTATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTACAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTTTGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo01 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo02 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo04 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 HDCo01 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HDCo03 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HSCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 JJCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0729 75 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0808 86 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 92 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 93 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH Asan15 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Youngam Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo03 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo02 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTANCTNTTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 SJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 SSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
AY097287.1 Corbicula fluminalis
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGCCTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAGCTAATCCGGCCTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTGGCAGGGGCTC
JAPAN AY097314.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA AF457992.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090396.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090397.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090398.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090399.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KX192336.1 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1116 DJCo-01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTANCTGGGGCTC
1116 DJCo-02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTANTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCANCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 DJCo-03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-04
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 DJCo-05
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-06
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGGGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-07
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-o1i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-o2i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 DJCo-o3i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 GRCo-01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 GRCo-02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 GRCo-03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 HD01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 KMRCFW222
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116 NJCo-01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 NJCo-02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116 NJCo-03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTANCTGGGGCTC

Ingresado el 01 de abril de 2022 por pintail pintail | 0 comentarios | Deja un comentario

10 de febrero de 2022

A phylogenetic tree of the genus Sinanodonta

I tried to draw a phylogenetic tree of the genus Sinanodonta. It was based on the data on the NCBI and the data I collected in Korea and analyzed myself.
I've been doing a little bit of analysis since 2019, so there's a lot of material I haven't found this time around. However, I was able to observe approximately Sinanodonta lauta, Sinanodonta cf woodiana 2, and Sinanodonta schrenckii in Korea.
And the species recorded as Sinanodonta woodiana (Sinanodonta cf. woodiana 1) from China, Southeast Asia and Europe appears to be a very close relative of Sinanodonta lauta. It was marked by guessing its location on the phylogenetic tree.

https://pintail1.ivyro.net/04homepage/2022/02_feb/20220211.htm
https://cafe.naver.com/yangpakor/41565

If I could afford it, I would like to draw a phylogenetic tree by comparing all long sequences, but when drawing a phylogenetic tree comparing all Korean freshwater clams, only 265 nucleotide sequences are being compared. I also drew a phylogenetic tree. As a result, it was found that there was no significant difference between the phylogenetic tree drawn with 265 and the phylogenetic tree drawn with 529.

Sinanodonta cf. woodiana 1, Sinanodonta cf. I hope that the classification of woodiana 2 will be sorted out soon.

MN809939.1 Sinanodonta lauta
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTGTATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
MT013157.1 Sinanodonta lauta
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTGTATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KY978737.1 Sinanodonta sp.
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTGTATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KY978742.1 Sinanodonta sp.
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTGGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATAGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGTGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGATCTCCTGGTTTGGTTGCTGAGCGGATCCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
MG463050.1 Sinanodonta sp.
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTTTTGGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTGCTTGTGCCAGCGTTATTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCTGGTGCTTCGTCTATTTTAGGCGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTCTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KJ434487.1 Sinanodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGGAGGCTTTTAGGGGATGATCAGCTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATAATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTGAGGTTTTGGTTGCTTGTGCCAGCGTTATTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
LC651630.1 Sinanodonta sp.
CGAGCAGAGTAGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAATTGTATAATGTTATTGTTTCGGCTCATGCTTTAATAATAATTTTCTTCTTAGTTATACCTATAATAATTGGGGGGTTTGGGAATTGATTAAATCGTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTGCTTGTAGCAGCGTTATTTTTATTTTTAAGATCTTCTTTAGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCCCCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCTTCTATTTTAGGCGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KX051328.1 Sinanodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAATTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATACCTATAATAATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTGCTTGTACCAGCGTTATTTTTATTATTAAGATCTTCTTTAGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCCCCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCTTCTATTTTAGGCGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KU891641.1 Sinanodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAATTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTAATACCTATAATAATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTGCTTGTACCAGCGTTATTTTTATTATTAAGATCTTCTTTAGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCCCCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCTTCTATTTTAGGCGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KY978744.1 Sinanodonta sp.
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTTTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGGTTAATTCCGTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTACTATTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATACCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGTGCTATTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACAGATCGTA
MG463064.1 Sinanodonta joreti
CGAGCGGAATTGGGTCAGCCCGGGAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATACCTATAATGATTGGGGGGTTTGGAAATTGGTTAATTCCCTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTGAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTATCTGGGAATGTTGCTCATTCTGGTGCTTCTGTGGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGTGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTATTTGTATGAGCTGTTACCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACAGATCGTA
KJ434489.1 Sinanodonta woodiana
CGAGCGGAATTGGGTCAGCCCGGGAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATACCTATAATGATTGGGGGGTTTGGAAATTGGTTAATTCCCTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTGAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTGGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGTGCTATTAATTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTATTTGTATGAGCTGTTACGGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACAGATCGTA
KJ434486.1 Sinanodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAGAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACGGATCGTA
MG581711.1 Sinanodonta aff. woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGTGCTGTTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACGGATCGTA
AF468683.1 Anodonta woodiana
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTTACGGATCGTA
MG463054.1 Sinanodonta angula
CGAGCAGAGTTAGGTCAACCAGGAAGGTTGTTGGGGGATGATCAGTTATATAATGTCATTGTGACGGCTCATGCTTTTATAATAATTTTCTTTTTGGTAATACCTATGATAATTGGGGGGTTTGGGAATTGACTTATTCCTTTAATAATTGGGGCTCCTGACATGGCTTTCCCTCGTTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTGCTTTTGAGGTCGTCTTTGGTGGAGAGGGGTGTTGGCACTGGGTGAACGGTATATCCTCCCTTGTCTGGGAATGTTGCCCATTCCGGGGCTTCTGTCGATTTAGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCTATCCTGGGGGCTATTAATTTTATTTCTACTGTTGGGAACATGCGTTCTCCCGGTTTGGTCGCTGAGCGAATTCCTTTGTTTGTGTGAGCTGTTACAGTTACAGCTGTTTTACTGGTCGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTGACGGATCGTA
MG463057.1 Sinanodonta angula
CGAGCAGAGTTAGGTCAACCAGGAAGGTTGTTGGGGGATGATCAGTTATATAATGTTATTGTGACGGCTCATGCTTTTATAATAATTTTCTTTTTGGTAATACCTATGATAATTGGGGGGTTTGGGAATTGACTTATTCCTTTAATAATTGGGGCTCCTGACATGGCTTTCCCTCGTTTAAATAATTTAAGGTTTTGGCTACTTGTGCCAGCGTTGTTTTTGCTTTTGAGGTCGTCTTTGGTGGAGAGGGGTGTTGGCACTGGGTGAACGGTATATCCTCCCTTGTCTGGGAATGTTGCCCATTCCGGGGCTTCTGTCGATTTAGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCTATCCTGGGGGCTATTAATTTTATTTCTACTGTTGGGAACATGCGTTCTCCCGGTTTGGTCGCTGAGCGAATTCCTTTGTTTGTGTGAGCTGTTACAGTTACAGCTGTTTTACTGGTCGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTTCTGACGGATCGTA
MG463066.1 Anodonta lucida
CGAGCAGAATTAGGTCAACCGGGAAGGTTGTTGGGGGATGATCAGCTATACAATGTTATTGTAACGGCTCATGCTTTTATGATAATTTTCTTTTTGGTAATACCTATAATAATTGGGGGATTTGGAAATTGGCTCATTCCTTTGATAATTGGGGCTCCTGATATAGCTTTCCCTCGTTTAAATAATTTAAGATTTTGGTTACTTGTGCCAGCGTTATTTTTGCTTTTAAGGTCATCTTTGGTGGAGAGGGGTGTTGGTACTGGGTGAACGGTGTATCCTCCTTTGTCTGGGAATGTTGCTCATTCCGGGGCTTCTGTTGATTTAGCTATCTTCTCTTTACACCTGGCCGGTGCTTCATCTATTTTAGGCGCTATTAATTTTATCTCTACTGTTGGGAATATGCGTTCTCCCGGTTTGGTCGCTGAGCGAATCCCTTTGTTTGTGTGAGCTGTTGCAGTTACAGCTGTTTTATTGGTCGCTGCTTTGCCTGTTTTAGCTGGGGCTATCACAATGCTTCTTACGGATCGTA
LC519023.1 Sinanodonta ogurae
CGAGCAGAGTTGGGTCAGCCGGGAAGGCTTTTAGGGGATGATCAGTTATATAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTGGTTATGCCTATGATGATTGGTGGGTTTGGGAATTGACTTATTCCTTTAATAATTGGGGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGGTTTTGATTACTTGTGCCAGCACTGTTTTTGCTTCTAAGGTCTTCTTTGGTTGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCTCCTTTATCAGGGAATGTTGCTCACTCTGGTGCTTCCGTTGATTTAGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCGTCTATTTTAGGTGCTATTAATTTTATTTCTACTGTTGGAAATATACGATCTCCTGGTTTGGTTGCCGAGCGAATTCCTTTATTTGTATGAGCTGTCACAGTAACAGCTGTTTTGTTGGTTGCTGCTTTGCCTGTGTTAGCAGGGGCTATTACAATACTTCTTACGGATCGTA
MK574233.1 Sinanodonta schrenkii
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTTTTAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGAGGGTTTGGGAATTGGCTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACAGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA
MK574232.1 Sinanodonta schrenkii
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTTTTAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGAGGGTTTGGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTGTTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACTGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA
LC519017.1 Sinanodonta lauta
CGAGCGGAGTTAGGTCAGCCTGGAAGGTTACTGGGGGACGATCAGCTGTATAATGTCATTGTTACGGCTCATGCTTTCATAATAATTTTTTTCTTGGTTATACCAATAATAATTGGGGGATTTGGGAATTGGCTTATTCCTCTAATAATTGGGGCTCCTGATATAGCTTTCCCTCGATTGAATAACTTGAGGTTTTGGCTGCTTGTACCAGCATTATTTTTGTTGTTAAGATCCTCTTTGGTAGAGAGGGGTGTTGGCACTGGGTGAACAGTATACCCACCTTTATCTGGGAATGTTGCTCATTCCGGTGCTTCTGTAGATTTGGCCATCTTTTCTTTGCACTTAGCTGGTGCTTCGTCAATTTTAGGGGCTATCAATTTTATTTCTACTGTAGGAAATATACGATCTCCAGGCTTGGTTGCTGAGCGAATTCCCTTATTTGTATGGGCTGTTACAGTAACAGCTGTTTTGCTGGTTGCTGCTTTACCTGTTTTGGCTGGCGCTATTACGATGCTTCTTACGGATCGAA
LC519016.1 Sinanodonta lauta
CGAGCAGAGTTGGGTCAGCCTGGAAGGCTGTTAGGAGATGATCAGTTATATAATGTTATCGTTACGGCTCATGCCTTTATGATAATTTTCTTTTTAGTTATACCAATGATAATTGGGGGATTTGGAAATTGACTTATTCCTTTGATAATTGGGGCTCCTGATATGGCCTTTCCTCGATTTAACAATTTAAGGTTTTGGCTGCTTGTACCAGCATTGTTTTTATTATTAAGATCCTCTTTGGTAGAAAGAGGTGTTGGTACTGGGTGAACAGTATATCCGCCTTTGTCTGGGAATGTTGCTCATTCCGGTGCTTCTGTAGATTTGGCCATTTTTTCTTTGCATTTGGCTGGTGCTTCATCAATTTTGGGGGCTATTAATTTTATTTCTACTGTAGGGAATATACGGTCTCCAGGTTTGGTTGCTGAGCGAATTCCCTTATTCGTATGGGCTGTGGCTGTAACAGCTGTTCTGCTGGTTGCTGCTTTACCTGTTTTGGCTGGTGCCATTACGATGCTTCTTACGGACCGTA
LC519021.1 Sinanodonta calipygos
CGAGCAGAGTTGGGTCAGCCTGGAAGGCTGTTAGGAGATGATCAGCTATATAATGTTATTGTTACGGCTCATGCCTTTATAATAATTTTCTTTTTAGTTATACCAATGATAATTGGGGGATTTGGAAATTGACTTATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGATTAAATAATTTAAGGTTTTGGCTGCTTGTACCAGCATTGTTTTTATTATTAAGATCCTCTTTGGTAGAAAGAGGTGTTGGTACTGGGTGAACAGTATATCCGCCTTTGTCTGGGAATGTTGCTCATTCCGGTGCCTCTGTAGATTTGGCCATTTTTTCTTTGCATTTAGCTGGTGCTTCATCAATTTTGGGGGCTATTAATTTTATTTCCACTGTAGGGAATATACGGTCTCCAGGTTTGGTTGCTGAGCGAATTCCCTTATTCGTATGGGCTGTGGCTGTAACAGCTGTTCTGCTGGTTGCTGCTTTACCTGTTTTGGCTGGTGCCATTACGATGCTTCTTACGGATCGTA
MK574183.1 Anodonta cygnea
CGAGCTGAATTGGGTCAGCCGGGGAGGTTATTGGGGGATGATCAGTTATATAATGTAATTGTTACAGCTCATGCATTTATGATAATTTTTTTTTTGGTGATGCCAATAATGATTGGGGGGTTTGGTAATTGGCTTATTCCTTTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTGAGGTTTTGGTTATTGGTGCCAGCTTTATTTCTGTTATTAAGATCGTCATTGGTAGAGAGTGGTGTTGGTACTGGGTGGACGGTATACCCTCCTTTGTCTGGGAATGTTGCTCATTCTGGAGCTTCAGTAGATCTGGCCATTTTTTCCTTACATCTTGCTGGTGCTTCATCAATTTTAGGGGCTATTAATTTTATTTCTACTGTTGGAAATATACGATCTCCAGGCTTAGTCGCTGAGCGAATTCCTTTGTTTGTATGGGCTGTTACGGTAACAGCTGTATTATTGGTTGCTGCTTTGCCTGTTTTAGCTGGTGCTATTACAATATTATTGACTGATCGTA
MK574178.1 Anodonta anatina
CGAGCCGAATTAGGCCAACCAGGAAGGTTGTTGGGGGATGATCAATTGTATAATGTAATTGTTACGGCTCATGCTTTCATGATAATTTTTTTTCTAGTAATACCGATGATGATTGGTGGATTTGGGAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCCTTTCCTCGATTAAATAATTTAAGATTTTGGCTTCTTGTGCCAGCTTTGTTTTTATTATTAAGATCGGCATTAGTGGAGAGTGGTGTTGGTACTGGTTGAACAGTATACCCTCCTTTATCTGGAAATGTTGCTCATTCTGGGGCTTCGGTAGATTTGGCCATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTTTAGGCGCTATTAATTTTATTTCTACTGTTGGTAATATGCGATCTCCTGGGTTAGTTGCTGAACGAATTCCTTTGTTTGTTTGGGCCGTTGCTGTGACAGCTGTGTTGTTGGTTGCTGCTTTACCAGTTTTGGCTGGTGCTATTACAATGTTGTTAACTGATCGTA
MK574180.1 Anodonta anatina
CGAGCCGAATTAGGCCAACCAGGAAGGTTGTTGGGAGATGATCAATTGTATAATGTAATTGTTACGGCTCATGCTTTCATGATAATTTTCTTTCTAGTAATACCGATGATAATTGGTGGATTTGGGAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCCTTCCCTCGATTGAATAATTTGAGATTTTGGCTTCTTGTGCCAGCTTTGTTTTTATTATTAAGATCGGCATTAGTTGAGAGTGGTGTTGGTACTGGTTGAACAGTATACCCCCCTTTATCTGGAAATGTTGCTCATTCTGGGGCTTCGGTAGATTTGGCCATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTTTAGGCGCTATTAATTTTATTTCTACTGTTGGTAATATGCGATCTCCTGGGTTAGTTGCTGAACGAATTCCTTTGTTTGTTTGGGCTGTTGCTGTGACAGCTGTGTTGTTGGTTGCTGCTTTACCAGTTTTGGCTGGTGCTATTACAATGTTGTTAACTGACCGTA
MK574179.1 Anodonta anatina
CGAGCCGAATTAGGCCAACCAGGAAGGTTGTTGGGAGATGATCAATTGTATAATGTAATTGTTACGGCTCATGCTTTCATGATAATTTTCTTTCTAGTAATACCGATGATAATTGGTGGATTTGGGAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCCTTCCCTCGATTGAATAATTTGAGATTTTGGCTTCTTGTGCCAGCTTTGTTTTTATTATTAAGATCGGCATTAGTTGAGAGTGGTGTTGGTACTGGTTGAACAGTATACCCCCCTTTATCTGGAAATGTTGCTCATTCTGGGGCTTCGGTAGATTTGGCCATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTTTAGGCGCCATTAATTTTATTTCTACTGTTGGTAATATGCGATCTCCTGGGTTAGTTGCTGAACGAATTCCTTTGTTTGTTTGGGCTGTTGCTGTGACAGCTGTGTTGTTGGTTGCTGCTTTACCAGTTTTGGCTGGTGCTATTACAATGTTGTTAACTGACCGTA
KOREA Sep 05
CGAGCGGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA Blue06
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA Blue50
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTGGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA Blue23
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTGGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA AS01
CGAGCAGAGTTGGGTCAACCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATTATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGAACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGAGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGTGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACAATGCTTCTTACGGATCGTA
KOREA 31-2
CGAGCGGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA 43
CGAGCGGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTACGTGCTATTAACTTTATTTCTACTGTACGAAATATACGGTCTCCTGGGTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAATTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA Sep 18
CGAGCGGAGTTGGGTCAGCCAGGAAGGCTTTTGGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATGATTTTCTTCTTAGTTATACCTATAATGATTGGGGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTACTGTAGGAAATATACGGTCTCCTGGTTTGGTTGCTGAGCGGATTCCTTTGTTTGTATGAGCTGTTAGCGTAACAGCTGTTTTATTAGTTGCTGCTTTGCCTGTTTTGGCAGGGGCTATTACGATGCTTCTTACAGATCGTA
KOREA 39
CGAGCAGAGTTGGGTCAGCCAGGAAGGCTTTTAGGGGATGATCAGTTGTATAATGTTATTGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTAGTTATACCTATAATGATTGGAGGGTTTGGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTACTGTGGGGAATATACGGTCTCCTGGTTTGGTTGCTGAGCGAATTCCTTTGTTTGTATGAGCTGTTACCGTAACAGCTATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCACGGGCTATTACAATGCTTCTTACCGATCTTA
KOREA 20
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTCCCAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATCCTCTTTTTAGTTATGCCTATAATAATTGGGGGGTTTGGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCATTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACTGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA
KOREA IS01
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTTTTAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGAGGGTTTGGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACAGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA
KOREA Blue13
CGAGCAGAGTTAGGCCAGCCAGGAAGGCTTTTAGGAGATGATCAGTTATACAATGTTATTGTTACAGCTCATGCTTTTATAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGAGGGTTTGGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGATGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTAGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTACTGTTGGGAATATGCGGTCTCCTGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTTACAGTAACAGCCATTTTATTAGTTGCTGCTTTGCCTGTTTTAGCAGGGGCTATTACAATGCTCCTTACAGATCGTA

Ingresado el 10 de febrero de 2022 por pintail pintail | 1 observación | 0 comentarios | Deja un comentario

06 de febrero de 2022

2022 Korean freshwater clams

Since November 2019, I have been exploring freshwater clams in Korea with Jae-Hoon Kim and Su-Min Seong. I introduce 28 kinds of Korean freshwater clams that have been identified through mtDNA analysis so far. I think there may be one more species in the genus Corbicula, but the shell has been obtained, but the genetic information has not yet been obtained.

https://pintail1.ivyro.net/04homepage/2022/02_feb/20220206.htm

2021 BSCo01 Corbicula japonica
GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
2021 BSCo04 Corbicula leana
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 HDCo01 Corbicula felnouilliana
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
2021 HDCo03 Corbicula japonica
GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
2021 JJCo01 Corbicula leana
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJCo01 Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJH 0729 75 Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJH 0808 86 Corbicula felnouilliana
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
2021 KJH Asan15 Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 KJH Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
2021 Pisidium coreanum
GGAAATTGGNTANTTCCNTTGATGTTGGTTGTTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGATTGTTACCTGTTGCATTAATGTTATTATTAGGTTCTGCTTACGTTGAAAGAG-GTGCTGGAACTGGTTGAACTATTTATCCNCCGTTGTCTGGGAATGTTGCTCAGGCTGGCCCTTCTNTANAGTTTGCTATTTTGTCTTTACATTTGGGTGGNGCTTCTTCTATTGCTGCATCTTTNAATT-TTTTGACTAC
2021 SSCo01 Corbicula leana
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20210808 151
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCG-GTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211114 GB-01
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATNCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
20211114 GB-02
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCNATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTANATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
20211114 GB-03
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCNATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
20211114 GB-04
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 GB-05
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 HG-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 HG-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 HG-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 HM-A
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 HM-B
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 JS-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 JS-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 MK
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211114 MK-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 MK-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211114 WS-A
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTACTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
20211114 WS-B
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAAATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
20211114 WS-C
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAAATCTTCGCTAGTGGANAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCNCTATCTGGGAACGTANCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACNTTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
20211116 158
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 159
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCNGCTGAATAACTTANNATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAANATCGTCTTTGGTANAANNAN-GNGTTGGTACTGGTTGAACANNGTATCCTCCTTTGTCANGGAATGTTGCTCATTCTGGANCTTCGNGG-ATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 160
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTANGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTANAAANAN-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGANCTTCANTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 161-2
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAANATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 162-1
GGGAATTGGCTTATTCCTCTAATGATNGGNGCTCCTGATATGGCTTTTCCTCGGCTGAATANCTNNANATTTTGGCTGCTTGNGCCNGNTTTGNTTTTGNTATTAAGATCNNCTTTGGTANAANGAG-GTGTTGGTACTGGTTGAACANTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGANCTTCNNTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCGTCAATTTTAGGTGCTATTAATT-TTATCTCTAC
20211116 162-2
GGGAATTGGCTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTANNATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTANAANNAN-GNGTTGGTACTGGTTGAACANTGTATCCTCCTTTGTCANGGAATGTTGCTCATTCTGGANCTTCNNNGGATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCGTCAATTTTAGGTGCTATTAATT-TTATCTCTAC
20211116 164
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTNNNATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAANATCGTCTTTGGTANAANNAN-GNGTTGGTACTGGTTGAACANNGTATCCTCCTTTGTCANGGAATGTTGCTCATTCTGGANCTTCNNNGGATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 165-1
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
20211116 166-1
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
20211116 DJCo-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCANCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-04
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-05
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-06
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-07
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-o1i
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-o2i
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 DJCo-o3i
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 GRCo-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 GRCo-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 GRCo-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 GRSi 01
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTACTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCCCCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
20211116 GRSi 02
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCANCGTTGTTTTTATTATTAAGATCTTCTTTGGTANAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTANCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTANGTGCTATTAACT-TTATTTCTAC
20211116 HD01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 KMRCFW222
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 KMRCFW224
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCG-GTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211116 KMRCFW225
GGAAATTGACTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTANGGNCNTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACANTGTATCCCCCTTTGTCANGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTANCTATTTTTTCTTTGCACCTTGCTGGNGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 KMRCFW226
GGAAATTGACTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTANCTATTTTTTCTTTGCACCTTGCTGGNGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 KMRCFW245
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTGAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCCTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTGCACCTTGCTGGTGCTTCATCGATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 KS-02
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 KS-03
GGAAATTGACTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTANCTATTTTTTCTTTACACCTTGCTGGNGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211116 NJCo-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 NJCo-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 NJCo-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
20211116 WJ-02
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
20211215_Aculamprotula sp_ND01
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
20211215_Aculamprotula sp_ND02
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
20211215_Buldowskia_flavotincta_Ane01.ab1
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
20211215_Buldowskia_flavotincta_Ane02.ab1
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
20211215_Buldowskia_flavotincta_Ane03.ab1
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
20211215_Koreosolenaia sitgyensis_ND03
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAG-GTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATT-TTATTTCTAC
20211215_Lanceolaria sp_ND04
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGGGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATTTTAGGTGCTATTAATT-TTATCTCTAC
20211215_Nodularia breviconcha_HS01
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
20211215_Nodularia douglasiae_Bre01
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
20211215_Nodularia douglasiae_Bre02
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
20211215_Nodularia douglasiae_Bre03
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
20211215_Nodularia douglasiae_GJ01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211215_Nodularia douglasiae_GJ03
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211215_Nodularia douglasiae_HR01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTGTCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
20211215_Nodularia sp_Uni01
GGTAATTGACTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAGAGTG-GCGTTGGTACTGGTTGAACAGTATATCCGCCTTTATCAGGTAATGTTGCTCATTCTGGGGCTTCTGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATCTCTAC
20211215_Nodularia sp_Uni03
GGTAATTGACTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAGAGTG-GCGTTGGTACTGGTTGAACAGTATATCCGCCTTTATCAGGTAATGTTGCTCATTCTGGGGCTTCTGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATCTCTAC
Aculamprotula sp 210729 66
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
Aculamprotula sp 210729 69
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
Aculamprotula sp JJ01
GGTAATTGGTTGATTCCTATGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGG-GTGGTGGAACTGGATGAACGATGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATGTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATT-TTATTTCTAC
Anemina arcaeformis 200522 AD21
GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Asan03
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Black13
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Black6
GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Blue10
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTAGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGGTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTCCATTTGGCTGGGGCTTCTTCGATTTTAGGGGCTATTAATT-TTATTTCTAC
Anemina arcaeformis Sep 26
GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATT-TTATTTCTAC
Anemina euscaphys 2020 MY01
GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATT-TTATTTCTAC
Anemina euscaphys Black12
GGGAATTGGCTTATTCCTTTAATGATAGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACCGTTTATCCTCCTCTGTCCGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGAGCTATTAATT-TTATTTCTAC
Anemina euscaphys Black14
GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGGGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATGTTAGGAGCTATTAATT-TCATTTCTAC
Anemina euscaphys Black15
GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATT-TTATTTCTAC
Ansung 01
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 02
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 03
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 04
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 06
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 09
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 10
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
Ansung 11
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAG-GTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATT-TTATTTCTAC
BSPc01 Potamocorbula amurensis
GGTAATTGATTAGTTCCTTTGATGTTAGCTGTTCCAGATATGGCGTTTGCTCGTATAAATAATTTAAGATTTTGAGTTCTTCCTTCTTCTTTTACATTAATGGGCTTTTCTCTTTTTAGTGAAGGTG-GTTTTGGTGGTGGGTGAACTCTTTACCCTCCTTTATCTAGAAATATTGCTCATTCTGGTCCAGCTATAGATTTTTTAATTTTGTCTCTTCATTTAGGGGGTTTGTCGTCAATTATGGCTTCTTTGAACT-TTTATAGGAC
Buldowskia flavotincta Buyeo 01
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCTCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
Buldowskia flavotincta SK01
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
Buldowskia flavotincta sk02
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
Buldowskia flavotincta SK06
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGGCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAG-GCGGAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTATCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACT-TTATTTCCAC
Buldowskia iwakawai 200225 18
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia iwakawai 200225 58
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia iwakawai 2020 KR01
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia iwakawai 2020 KR02
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia iwakawai 2020 SC01
GGAAATTGACTCCTTCCTTTGATGATTGGCCCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCAGATTGCTCGTGCCCTCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAG-GTGTAAGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCGTCTGGCTGGGGCTTCCTCAATTTTATGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini 200225 40
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini 200225 55
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini 200225 fatSeosan2
GGAAACTGACTTATTCCTTTAATAATTGGGGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini Blue28
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini Blue31
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Buldowskia shadini us23
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTG-GTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATT-TTATTTCTAC
Cristaria plicata 2019
GGGAATTGACTTATTCCACTAATAATTGGTGCTCCCGATATGGCTTTTCCTCGCCTAAATAACCTGAGGTTTTGATTACTTGTACCGGCATTGTTTTTACTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGGACGGTATATCCGCCCTTATCCGGAAATGTTGCTCACTCTGGGGCTTCTGTAGATTTGGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCCATTAATT-TTATTTCTAC
HYTr Musculium lacustre
GGAAATTGATTGGTACCATTAATATTANTGGTTCCTGATATAGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTATTACCTGTTGCATTATTGTTATTGTTAGGATCAGCTTATGTAGAGAGAG-GAGCTGGAACTGGGTGAACTATCTATCCCCCATTGTCTGGAAATGTAGCTCATGCTGGACCTTCAATANAATTTGCAATTTTGTCTTTACATTTAGGTGGTGCTTCATCTATTGCTGCATCAATTAATT-TTTTAACTAC
Inversiunio verrucisus 2020 BS04
GGTAATTGACTTATTCCTCTGATAATTGGTGCTCCTGATATGGCTTTTCCACGATTAAACAATTTGAGTTTTTGGTTGCTTGTCCCAGCCTTGTTTTTGTTGTTAAGTTCGTCTTTGGTAGAGAGGG-GTGTTGGTACTGGTTGAACAGTATATCCACCTTTGTCTGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTGGCTATTTTTTCATTACATCTTGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
KOREA AF457992.1 Corbicula sp.
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATT-TTGTTGTCAC
KOREA EU090397.1 Corbicula sp.
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTG-GTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATT-TTGTTGTCAC
KOREA EU090399.1 Corbicula sp.
GGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTG-GAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATT-TTGTTGTTAC
Koreosolenaia sitgyensis 2020 BS02
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCTTTGGTTGAGAGAG-GTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGTGCTATTAATT-TTATTTCTAC
Koreosolenaia sitgyensis 210729 64
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAG-GTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATT-TTATTTCTAC
Koreosolenaia sitgyensis 210729 65
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAG-GTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATT-TTATTTCTAC
Lamprotula leaii 2020 BS06
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCG-GTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Lamprotula seomjinensis 210729 152
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGACATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTGTTAAGATCTTCGTTGGTAGAGAGAG-GTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCACTCCGGGGCTTCGGTAGACTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Lanceolaria acrorrhyncha 2019
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAG-GTGTTGGTACTGGTTGAACTATGTATCCCCCTTTGTCAAGAAATGCTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATT-TTATCTCTAC
Lanceolaria sp MK01
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATT-TTATCTCTAC
Lanceolaria sp MK02
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAG-GTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCGTCAATTTTAGGTGCTATTAATT-TTATCTCTAC
NCBI DQ264395.1 Limnoperna fortunei
GGGAATTGGTTGATTCCATTAATAATAGGGGCAGTAGATTTGATTTTTCCACGATTGAATAATATAAGGTACTGRTTTCTTTTTTTTTCCTTAGGACTTTTTTTATTGTCTATGCATGTAGAGGGTG-GAGTAGGGACTGGTTGGACAGTTTATCCTCCTTTATCTAGTTTTGATGCTCATAGAACCCCAGCAGTTGACATAGCTGCTTTATCTCTTCATTTAGCTGGTGCGTCGTCAATTGGCGGTTCGTTAAATT-ATATTACTAG
NCBI MT020521.1 Aculamprotula coreana
GGTAATTGGTTAATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTCCCTCGTTTAAATAATTTGAGGTTTTGGCTACTTGTTCCAGCTTTATTTTTGTTGTTGAGATCATCTTTAGTGGAAAGGG-GTGTAGGCACTGGGTGGACAGTGTATCCGCCTTTAGCAGGAAATGTTGCTCATTCTGGAGCTTCGGTAGATTTGGCTATTTTTTCTTTACACTTAGCCGGTGCTTCGTCTATTTTGGGGGCTATTAATT-TTATCTCTAC
Nodularia breviconcha 200522 JH05
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha 200522 JH06
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha 200522 YS03
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATT-TCATTTCTAC
Nodularia breviconcha 200522 YS04
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATT-TCATTTCTAC
Nodularia breviconcha 2020 BS07
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCATTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha 210729 71
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATT-TCATTTCTAC
Nodularia breviconcha Blue18
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha Blue32
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha Blue35
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATT-TCATTTCTAC
Nodularia breviconcha Blue43
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha HC02
GGGAATTGACTTATTCCCTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia breviconcha KJ02
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCG-GTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGAGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATTTCTAC
Nodularia douglasiae 200225 ADND3
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTGTCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae 200225 BYND2
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCTTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae 2019
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae 210729 154
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGNTAATGTTGCTCATTCTGGAGCTTCTGTANATTTANCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae 210729 70
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae Blue17
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTGGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae CH01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae JN01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCAGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae LUS02
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Nodularia douglasiae sk03
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTG-GTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATT-TTATTTCTAC
Sinanodonta cf woodiana 2 200225 39
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGG-GCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATT-TTATTTCTAC
Sinanodonta cf woodiana 2 Blue40
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGG-GCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATT-TTATTTCTAC
Sinanodonta lauta 1
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta 200225 31
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta 200225 43
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTACGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta 2019
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta 2019 02
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTGTTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta AS01
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGAACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGAGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Blue23
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Blue33
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Blue50
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Blue6
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Sep 05
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta lauta Sep 18
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGG-GCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACT-TTATTTCTAC
Sinanodonta schrenckii Blue13
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGG-GTGTTGGAACAGGATGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTAGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATT-TTATTTCTAC
Sinanodonta schrenkii 200225 20
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCATTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGG-GTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATT-TTATTTCTAC
Sinanodonta schrenkii 200225 21
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAAAGGG-GTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATT-TTATTTCTAC
Sinanodonta schrenkii 200522 IS01
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGG-GTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATT-TTATTTCTAC
Uni0220211215_Nodularia sp_Uni02
GGTAATTGACTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAGAGTG-GCGTTGGTACTGGTTGAACAGTATATCCGCCTTTATCAGGTAATGTTGCTCATTCTGGGGCTTCTGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACT-TCATCTCTAC

Ingresado el 06 de febrero de 2022 por pintail pintail | 1 observación | 0 comentarios | Deja un comentario

16 de noviembre de 2021

This is the genetic information of Korean freshwater clam COI analyzed between 2019 and 2021.

This is the genetic information of Korean freshwater clam COI analyzed between 2019 and 2021.

COI in Mithchondria

https://cafe.naver.com/yangpakor/41180

Ansung 01
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Ansung 02
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Ansung 03
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Ansung 04
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Ansung 06
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Ansung 09
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Ansung 10
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Ansung 11
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Sinanodonta schrenkii 200522 IS01
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC
Sinanodonta schrenkii 200225 21
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAAAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC
Sinanodonta schrenkii 200225 20
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCATTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC
Sinanodonta schrenckii Blue13
GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGATGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTAGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC
Sinanodonta lauta Sep 18
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta Sep 05
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta Blue6
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta Blue50
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta Blue33
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta Blue23
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta AS01
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGAACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGAGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta 2019 02
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTGTTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta 2019
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta 200225 43
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTACGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta 200225 31
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta lauta 1
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
Sinanodonta cf woodiana 2 Blue40
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTAC
Sinanodonta cf woodiana 2 200225 39
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTAC
Nodularia douglasiae sk03
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia douglasiae LUS02
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia douglasiae JN01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCAGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia douglasiae CH01
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia douglasiae Blue17
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTGGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia douglasiae 210729 70
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia douglasiae 210729 154
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGNTAATGTTGCTCATTCTGGAGCTTCTGTANATTTANCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia douglasiae 2019
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia douglasiae 200225 BYND2
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCTTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia douglasiae 200225 ADND3
GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTGTCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Nodularia breviconcha KJ02
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGAGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC
Nodularia breviconcha HC02
GGGAATTGACTTATTCCCTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC
Nodularia breviconcha Blue43
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC
Nodularia breviconcha Blue35
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC
Nodularia breviconcha Blue32
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC
Nodularia breviconcha Blue18
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC
Nodularia breviconcha 210729 71
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC
Nodularia breviconcha 2020 BS07
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCATTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC
Nodularia breviconcha 200522 YS04
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC
Nodularia breviconcha 200522 YS03
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC
Nodularia breviconcha 200522 JH06
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC
Nodularia breviconcha 200522 JH05
GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC
NCBI MT020521.1 Aculamprotula coreana
GGTAATTGGTTAATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTCCCTCGTTTAAATAATTTGAGGTTTTGGCTACTTGTTCCAGCTTTATTTTTGTTGTTGAGATCATCTTTAGTGGAAAGGGGTGTAGGCACTGGGTGGACAGTGTATCCGCCTTTAGCAGGAAATGTTGCTCATTCTGGAGCTTCGGTAGATTTGGCTATTTTTTCTTTACACTTAGCCGGTGCTTCGTCTATTTTGGGGGCTATTAATTTTATCTCTAC
NCBI DQ264395.1 Limnoperna fortunei
GGGAATTGGTTGATTCCATTAATAATAGGGGCAGTAGATTTGATTTTTCCACGATTGAATAATATAAGGTACTGRTTTCTTTTTTTTTCCTTAGGACTTTTTTTATTGTCTATGCATGTAGAGGGTGGAGTAGGGACTGGTTGGACAGTTTATCCTCCTTTATCTAGTTTTGATGCTCATAGAACCCCAGCAGTTGACATAGCTGCTTTATCTCTTCATTTAGCTGGTGCGTCGTCAATTGGCGGTTCGTTAAATTATATTACTAG
Lanceolaria sp MK02
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCGTCAATTTTAGGTGCTATTAATTTTATCTCTAC
Lanceolaria sp MK01
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC
Lanceolaria acrorrhyncha 2019
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACTATGTATCCCCCTTTGTCAAGAAATGCTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATTTTATCTCTAC
Lamprotula seomjinensis 210729 152
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGACATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTGTTAAGATCTTCGTTGGTAGAGAGAGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCACTCCGGGGCTTCGGTAGACTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Lamprotula leaii 2020 BS06
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
Koreosolenaia sitgyensis 210729 65
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATTTTATTTCTAC
Koreosolenaia sitgyensis 210729 64
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATTTTATTTCTAC
Koreosolenaia sitgyensis 2020 BS02
GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCTTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGTGCTATTAATTTTATTTCTAC
KOREA EU090397.1 Corbicula sp.
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCAC
KOREA EU090399.1 Corbicula sp.
GGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC
KOREA AF457992.1 Corbicula sp.
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
Inversiunio verrucisus 2020 BS04
GGTAATTGACTTATTCCTCTGATAATTGGTGCTCCTGATATGGCTTTTCCACGATTAAACAATTTGAGTTTTTGGTTGCTTGTCCCAGCCTTGTTTTTGTTGTTAAGTTCGTCTTTGGTAGAGAGGGGTGTTGGTACTGGTTGAACAGTATATCCACCTTTGTCTGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTGGCTATTTTTTCATTACATCTTGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
HYTr Musculium lacustre
GGAAATTGATTGGTACCATTAATATTANTGGTTCCTGATATAGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTATTACCTGTTGCATTATTGTTATTGTTAGGATCAGCTTATGTAGAGAGAGGAGCTGGAACTGGGTGAACTATCTATCCCCCATTGTCTGGAAATGTAGCTCATGCTGGACCTTCAATANAATTTGCAATTTTGTCTTTACATTTAGGTGGTGCTTCATCTATTGCTGCATCAATTAATTTTTTAACTAC
Cristaria plicata 2019
GGGAATTGACTTATTCCACTAATAATTGGTGCTCCCGATATGGCTTTTCCTCGCCTAAATAACCTGAGGTTTTGATTACTTGTACCGGCATTGTTTTTACTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGGACGGTATATCCGCCCTTATCCGGAAATGTTGCTCACTCTGGGGCTTCTGTAGATTTGGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCCATTAATTTTATTTCTAC
Buldowskia shadini us23
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC
Buldowskia shadini Blue31
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC
Buldowskia shadini Blue28
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC
Buldowskia shadini 200225 fatSeosan2
GGAAACTGACTTATTCCTTTAATAATTGGGGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC
Buldowskia shadini 200225 55
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC
Buldowskia shadini 200225 40
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC
Buldowskia iwakawai 2020 SC01
GGAAATTGACTCCTTCCTTTGATGATTGGCCCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCAGATTGCTCGTGCCCTCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAAGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCGTCTGGCTGGGGCTTCCTCAATTTTATGTGCTATTAATTTTATTTCTAC
Buldowskia iwakawai 2020 KR02
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC
Buldowskia iwakawai 2020 KR01
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC
Buldowskia iwakawai 200225 58
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC
Buldowskia iwakawai 200225 18
GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC
Buldowskia flavotincta SK06
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGGCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGGAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTATCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC
Buldowskia flavotincta sk02
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC
Buldowskia flavotincta SK01
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC
Buldowskia flavotincta Buyeo 01
GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCTCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC
BSPc01 Potamocorbula amurensis
GGTAATTGATTAGTTCCTTTGATGTTAGCTGTTCCAGATATGGCGTTTGCTCGTATAAATAATTTAAGATTTTGAGTTCTTCCTTCTTCTTTTACATTAATGGGCTTTTCTCTTTTTAGTGAAGGTGGTTTTGGTGGTGGGTGAACTCTTTACCCTCCTTTATCTAGAAATATTGCTCATTCTGGTCCAGCTATAGATTTTTTAATTTTGTCTCTTCATTTAGGGGGTTTGTCGTCAATTATGGCTTCTTTGAACTTTTATAGGAC
Anemina euscaphys Black15
GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATTTTATTTCTAC
Anemina euscaphys Black14
GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGGGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATGTTAGGAGCTATTAATTTCATTTCTAC
Anemina euscaphys Black12
GGGAATTGGCTTATTCCTTTAATGATAGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACCGTTTATCCTCCTCTGTCCGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGAGCTATTAATTTTATTTCTAC
Anemina euscaphys 2020 MY01
GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATTTTATTTCTAC
Anemina arcaeformis Sep 26
GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC
Anemina arcaeformis Blue10
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTAGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGGTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTCCATTTGGCTGGGGCTTCTTCGATTTTAGGGGCTATTAATTTTATTTCTAC
Anemina arcaeformis Black6
GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC
Anemina arcaeformis Black13
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Anemina arcaeformis Asan03
GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC
Anemina arcaeformis 200522 AD21
GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC
Aculamprotula sp JJ01
GGTAATTGGTTGATTCCTATGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGGTGGAACTGGATGAACGATGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATGTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC
Aculamprotula sp 210729 69
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC
Aculamprotula sp 210729 66
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC
2021 SSCo01 Corbicula leana
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
2021 Pisidium coreanum
GGAAATTGGNTANTTCCNTTGATGTTGGTTGTTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGATTGTTACCTGTTGCATTAATGTTATTATTAGGTTCTGCTTACGTTGAAAGAGGTGCTGGAACTGGTTGAACTATTTATCCNCCGTTGTCTGGGAATGTTGCTCAGGCTGGCCCTTCTNTANAGTTTGCTATTTTGTCTTTACATTTGGGTGGNGCTTCTTCTATTGCTGCATCTTTNAATTTTTTGACTAC
2021 KJH Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
2021 KJH Asan15 Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
2021 KJH 0808 86 Corbicula felnouilliana
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
2021 KJH 0729 75 Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
2021 KJCo01 Corbicula fluminea
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
2021 JJCo01 Corbicula leana
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
2021 HDCo03 Corbicula japonica
GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC
2021 HDCo01 Corbicula felnouilliana
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC
2021 BSCo04 Corbicula leana
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
2021 BSCo01 Corbicula japonica
GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC
2021 08 08 151
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
20211116 158
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC
20211116 159
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCNGCTGAATAACTTANNATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAANATCGTCTTTGGTANAANNANGNGTTGGTACTGGTTGAACANNGTATCCTCCTTTGTCANGGAATGTTGCTCATTCTGGANCTTCGNGG-ATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC
20211116 160
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTANGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTANAAANANGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGANCTTCANTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC
20211116 161-2
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAANATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC
20211116 162-1
GGGAATTGGCTTATTCCTCTAATGATNGGNGCTCCTGATATGGCTTTTCCTCGGCTGAATANCTNNANATTTTGGCTGCTTGNGCCNGNTTTGNTTTTGNTATTAAGATCNNCTTTGGTANAANGAGGTGTTGGTACTGGTTGAACANTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGANCTTCNNTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCGTCAATTTTAGGTGCTATTAATTTTATCTCTAC
20211116 162-2
GGGAATTGGCTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTANNATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTANAANNANGNGTTGGTACTGGTTGAACANTGTATCCTCCTTTGTCANGGAATGTTGCTCATTCTGGANCTTCNNNGGATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCGTCAATTTTAGGTGCTATTAATTTTATCTCTAC
20211116 164
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTNNNATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAANATCGTCTTTGGTANAANNANGNGTTGGTACTGGTTGAACANNGTATCCTCCTTTGTCANGGAATGTTGCTCATTCTGGANCTTCNNNGGATTTGGCTATTTTTTCTTTACATCTTGCTGGNGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC
20211116 165-1
GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC
20211116 166-1
GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC
20211116 DJCo-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCAC
20211116 DJCo-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCANCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 DJCo-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 DJCo-04
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 DJCo-05
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 DJCo-06
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 DJCo-07
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 DJCo-o1i
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 DJCo-o2i
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 DJCo-o3i
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 GRCo-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 GRCo-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 GRCo-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 GRSi 01
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTACTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCCCCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
20211116 GRSi 02
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCANCGTTGTTTTTATTATTAAGATCTTCTTTGGTANAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTANCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTANGTGCTATTAACTTTATTTCTAC
20211116 HD01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 KMRCFW222
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 KMRCFW224
GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC
20211116 KMRCFW225
GGAAATTGACTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTANGGNCNTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACANTGTATCCCCCTTTGTCANGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTANCTATTTTTTCTTTGCACCTTGCTGGNGCTTCATCAATTTTGGGTGCTATTAATTTTATCTCTAC
20211116 KMRCFW226
GGAAATTGACTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTANCTATTTTTTCTTTGCACCTTGCTGGNGCTTCATCAATTTTGGGTGCTATTAATTTTATCTCTAC
20211116 KMRCFW245
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTGAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCCCCCTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTGCACCTTGCTGGTGCTTCATCGATTTTGGGTGCTATTAATTTTATCTCTAC
20211116 KS-02
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATTTTATCTCTAC
20211116 KS-03
GGAAATTGACTTATTCCTCTAATGATTGGNGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTANCTATTTTTTCTTTACACCTTGCTGGNGCTTCATCAATTTTGGGTGCTATTAATTTTATCTCTAC
20211116 NJCo-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 NJCo-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 NJCo-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211116 WJ-02
GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCCCCTTTGTCAGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATTTTATCTCTAC
20211114 WS-A
GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTACTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC
20211114 WS-B
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAAATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC
20211114 WS-C
GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAAATCTTCGCTAGTGGANAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCNCTATCTGGGAACGTANCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACNTTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC
20211114 MK
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211114 MK-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCAC
20211114 MK-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCAC
20211114 JS-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCAC
20211114 JS-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCAC
20211114 HM-B
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211114 HM-A
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211114 HG-03
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211114 HG-02
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCAC
20211114 HG-01
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211114 GB-05
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCAC
20211114 GB-04
GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC
20211114 GB-03
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCNATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC
20211114 GB-02
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCNATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTANATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC
20211114 GB-01
GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATNCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

Ingresado el 16 de noviembre de 2021 por pintail pintail | 0 comentarios | Deja un comentario

The Corbicula group living in Korea is divided into 4 species.

https://cafe.naver.com/yangpakor/41178

About eight species of Corbicula herds living in Korea are currently being talked about. However, it seems that it can be roughly divided into four species, and when looking at the mtDNA information recorded in the NCBI, I think that one more species can be added in the future.

Corbicula leana and Corbicula fluminea should be viewed as different species. However, the distinction between these two species is not easy.

We uploaded the COI gene data from the mtDNA of the Corbicula herd collected in Korea so far, so compare it with the surrounding individuals.

1114 GoBook 01
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
1114 GoBook 02
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
1114 GoBook 03
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
1114 GoBook 04
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 GoBook 05
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HanGang 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HanGang 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HG 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HaeMi-A
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 HaeMi-B
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 JookSung 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 JookSung 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 MoonKyeng 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 MoonKyeng 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTATTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAAAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 DJCo 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 04
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 DJCo 05
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo 07
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo o1i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo o2i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 DJCo o3i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 GRCo 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 GRCo 02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 GRCo 03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 HD01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 KMRCFW222
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1114 NJCo 01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 NJCo 02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1114 NJCo 03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Joonam 01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATGCTTTTGTTGGTTANATCANCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTNGAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Joonam 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Joonam 03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAgTGATGCCAATAATAATGGGtGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATANCTATGCTTTTGTTGGTTAAATCANCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Joonam 04
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Joonam 05
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAgTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAgCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTGGTTAAATCANCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTNNAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Najoo 01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Najoo 02
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Najoo 03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGNGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTANATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
Seosan 01
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATNCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTNGCANTATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Seosan 02
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGNAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Seosan 04
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCNATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTNGCANTATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Wanjoo A
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATNATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGNTATNCTTTTGTTGGTGAGATCANCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTNGCANTATTGCTCATTCTGGTCCTTCGGNAGATTTGGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
Wanjoo B
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATNGCTATNCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
Wanjoo C
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATNGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211240.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211241.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211242.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGAGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211243.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTCAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATACGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211244.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCCTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCCTGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCCATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTTTGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211245.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTATTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211246.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCGATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211247.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATCCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211248.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGTTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211249.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTGACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211250.1 Corbicula largillierti
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCCAGAAATATTGCTCATTCTGGCCCATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211251.1 Corbicula largillierti
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCCAGAAATATTGCTCATTCTGGCCCATCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211252.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATACCTGTATTAGCTGGAGCTC
2018 KC211253.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTATTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211254.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTGTTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211255.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211256.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTACTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211257.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211258.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211259.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGTTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211260.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCCATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTGGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211261.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211262.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTATATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGGATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211263.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTTCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211264.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTTCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211265.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAATTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211266.1 Corbicula africana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTTCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTGGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCACAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211267.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTTATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211268.1 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211269.1 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211270.1 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211271.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGAACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211272.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211273.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211274.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211275.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGAGCTC
2018 KC211276.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTGAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2018 KC211277.1 Corbicula sandai
TTTTAGTGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCGTTAATGCTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211279.1 Corbicula sandai
TTTTAGTGTAATTATTCGAATAGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCGTTAATGCTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211280.1 Corbicula sandai
TTTTAGTGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCGTTAATGCTAAGGGCTCCTGATATGGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGATGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGTTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211281.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211282.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATATTGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCCATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211283.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211284.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTTATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211285.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTTATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAACGCCTGTGTTAGCTGGGGCTC
2018 KC211286.1 Corbicula fluminea
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCCATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATATGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2018 KC211287.1 Corbicula leana
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTTATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211288.1 Corbicula leana
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2018 KC211289.1 Corbicula leana
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCCGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCTATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTACAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTTTGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo01 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo02 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo04 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 HDCo01 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HDCo03 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HSCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 JJCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0729 75 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0808 86 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 92 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 93 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH Asan15 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Youngam Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo03 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo02 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTANCTNTTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 SJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 SSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
AY097287.1 Corbicula fluminalis
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGCCTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAGCTAATCCGGCCTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTGGCAGGGGCTC
JAPAN AY097314.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA AF457992.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090396.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090397.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090398.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090399.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KX192336.1 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
1116_DJCo-01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTANCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTANCTGGGGCTC
1116_DJCo-02
TTTTAGGGTAaTTATTcgAaTGGAGCTTGCTATTCCAGGGACTTTATTagaTGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTANTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCANCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116_DJCo-03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116_DJCo-04
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116_DJCo-05
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116_DJCo-06
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGGGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116_DJCo-07
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116_DJCo-o1i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116_DJCo-o2i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116_DJCo-o3i
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116_GRCo-01
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTANATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116_GRCo-02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAAATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116_GRCo-03
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116_HD01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116_KMRCFW222
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTANAAATATTGCTCATTCTGGCCCGTCAGTAAATTTANCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
1116_NJCo-01
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116_NJCo-02
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATANCTTTTCCACGGTTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTANATCAGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTANAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
1116_NJCo-03
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAANATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAAATCGGCTTATGTTGANAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAAAAATATTGCTCATTCTGGCCCGTCAGTANATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTANCTGGGGCTC

Ingresado el 16 de noviembre de 2021 por pintail pintail | 0 comentarios | Deja un comentario

14 de septiembre de 2021

COI 266bps / Freshwater Clam / South Korea

COI 266bps / Freshwater Clam / South Korea..

https://pintail1.ivyro.net/04homepage/kongju/pintail/2021/09_September/20210919.htm



Sinanodonta schrenkii 200522 IS01

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta schrenkii 200225 21

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAAAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta schrenkii 200225 20

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCATTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta schrenckii Blue13

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGATGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTAGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta lauta Sep 18

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Sep 05

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue6

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue50

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue33

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue23

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta AS01

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGAACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGAGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 2019 02

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTGTTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 2019

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 200225 43

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTACGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 200225 31

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 1

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta cf woodiana 2 Blue40

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTAC

Sinanodonta cf woodiana 2 200225 39

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTAC

Nodularia douglasiae sk03

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae LUS02

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae JN01

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCAGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae CH01

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae Blue17

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTGGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 210729 70

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 210729 154

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGNTAATGTTGCTCATTCTGGAGCTTCTGTANATTTANCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 2019

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 200225 BYND2

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCTTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 200225 ADND3

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTGTCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia breviconcha KJ02

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGAGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha HC02

GGGAATTGACTTATTCCCTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha Blue43

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha Blue35

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha Blue32

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha Blue18

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha 210729 71

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha 2020 BS07

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCATTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha 200522 YS04

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha 200522 YS03

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha 200522 JH06

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha 200522 JH05

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

NCBI MT020521.1 Aculamprotula coreana

GGTAATTGGTTAATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTCCCTCGTTTAAATAATTTGAGGTTTTGGCTACTTGTTCCAGCTTTATTTTTGTTGTTGAGATCATCTTTAGTGGAAAGGGGTGTAGGCACTGGGTGGACAGTGTATCCGCCTTTAGCAGGAAATGTTGCTCATTCTGGAGCTTCGGTAGATTTGGCTATTTTTTCTTTACACTTAGCCGGTGCTTCGTCTATTTTGGGGGCTATTAATTTTATCTCTAC

NCBI DQ264395.1 Limnoperna fortunei

GGGAATTGGTTGATTCCATTAATAATAGGGGCAGTAGATTTGATTTTTCCACGATTGAATAATATAAGGTACTGRTTTCTTTTTTTTTCCTTAGGACTTTTTTTATTGTCTATGCATGTAGAGGGTGGAGTAGGGACTGGTTGGACAGTTTATCCTCCTTTATCTAGTTTTGATGCTCATAGAACCCCAGCAGTTGACATAGCTGCTTTATCTCTTCATTTAGCTGGTGCGTCGTCAATTGGCGGTTCGTTAAATTATATTACTAG

Lanceolaria sp MK02

GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCGTCAATTTTAGGTGCTATTAATTTTATCTCTAC

Lanceolaria sp MK01

GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC

Lanceolaria acrorrhyncha 2019

GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACTATGTATCCCCCTTTGTCAAGAAATGCTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATTTTATCTCTAC

Lamprotula seomjinensis 210729 152

GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGACATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTGTTAAGATCTTCGTTGGTAGAGAGAGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCACTCCGGGGCTTCGGTAGACTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Lamprotula leaii 2020 BS06

GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Koreosolenaia sitgyensis 210729 65

GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATTTTATTTCTAC

Koreosolenaia sitgyensis 210729 64

GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATTTTATTTCTAC

Koreosolenaia sitgyensis 2020 BS02

GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCTTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGTGCTATTAATTTTATTTCTAC

KOREA EU090399.1 Corbicula sp.

GGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

KOREA EU090397.1 Corbicula sp.

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCAC

KOREA AF457992.1 Corbicula sp.

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

Inversiunio verrucisus 2020 BS04

GGTAATTGACTTATTCCTCTGATAATTGGTGCTCCTGATATGGCTTTTCCACGATTAAACAATTTGAGTTTTTGGTTGCTTGTCCCAGCCTTGTTTTTGTTGTTAAGTTCGTCTTTGGTAGAGAGGGGTGTTGGTACTGGTTGAACAGTATATCCACCTTTGTCTGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTGGCTATTTTTTCATTACATCTTGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

HYTr Musculium lacustre

GGAAATTGATTGGTACCATTAATATTANTGGTTCCTGATATAGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTATTACCTGTTGCATTATTGTTATTGTTAGGATCAGCTTATGTAGAGAGAGGAGCTGGAACTGGGTGAACTATCTATCCCCCATTGTCTGGAAATGTAGCTCATGCTGGACCTTCAATANAATTTGCAATTTTGTCTTTACATTTAGGTGGTGCTTCATCTATTGCTGCATCAATTAATTTTTTAACTAC

Cristaria plicata 2019

GGGAATTGACTTATTCCACTAATAATTGGTGCTCCCGATATGGCTTTTCCTCGCCTAAATAACCTGAGGTTTTGATTACTTGTACCGGCATTGTTTTTACTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGGACGGTATATCCGCCCTTATCCGGAAATGTTGCTCACTCTGGGGCTTCTGTAGATTTGGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCCATTAATTTTATTTCTAC

Buldowskia shadini us23

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini Blue31

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini Blue28

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini 200225 fatSeosan2

GGAAACTGACTTATTCCTTTAATAATTGGGGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini 200225 55

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini 200225 40

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 2020 SC01

GGAAATTGACTCCTTCCTTTGATGATTGGCCCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCAGATTGCTCGTGCCCTCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAAGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCGTCTGGCTGGGGCTTCCTCAATTTTATGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 2020 KR02

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 2020 KR01

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 200225 58

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 200225 18

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia flavotincta SK06

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGGCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGGAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTATCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

Buldowskia flavotincta sk02

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

Buldowskia flavotincta SK01

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

Buldowskia flavotincta Buyeo 01

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCTCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

BSPc01 Potamocorbula amurensis

GGTAATTGATTAGTTCCTTTGATGTTAGCTGTTCCAGATATGGCGTTTGCTCGTATAAATAATTTAAGATTTTGAGTTCTTCCTTCTTCTTTTACATTAATGGGCTTTTCTCTTTTTAGTGAAGGTGGTTTTGGTGGTGGGTGAACTCTTTACCCTCCTTTATCTAGAAATATTGCTCATTCTGGTCCAGCTATAGATTTTTTAATTTTGTCTCTTCATTTAGGGGGTTTGTCGTCAATTATGGCTTCTTTGAACTTTTATAGGAC

Anemina euscaphys Black15

GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATTTTATTTCTAC

Anemina euscaphys Black14

GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGGGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATGTTAGGAGCTATTAATTTCATTTCTAC

Anemina euscaphys Black12

GGGAATTGGCTTATTCCTTTAATGATAGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACCGTTTATCCTCCTCTGTCCGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGAGCTATTAATTTTATTTCTAC

Anemina euscaphys 2020 MY01

GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATTTTATTTCTAC

Anemina arcaeformis Sep 26

GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis Blue10

GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTAGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGGTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTCCATTTGGCTGGGGCTTCTTCGATTTTAGGGGCTATTAATTTTATTTCTAC

Anemina arcaeformis Black6

GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis Black13

GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis Asan03

GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis 200522 AD21

GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC

Aculamprotula sp JJ01

GGTAATTGGTTGATTCCTATGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGGTGGAACTGGATGAACGATGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATGTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC

Aculamprotula sp 210729 69

GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC

Aculamprotula sp 210729 66

GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC

2021 SSCo01 Corbicula leana

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 Pisidium coreanum

GGAAATTGGNTANTTCCNTTGATGTTGGTTGTTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGATTGTTACCTGTTGCATTAATGTTATTATTAGGTTCTGCTTACGTTGAAAGAGGTGCTGGAACTGGTTGAACTATTTATCCNCCGTTGTCTGGGAATGTTGCTCAGGCTGGCCCTTCTNTANAGTTTGCTATTTTGTCTTTACATTTGGGTGGNGCTTCTTCTATTGCTGCATCTTTNAATTTTTTGACTAC

2021 KJH Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJH Asan15 Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJH 0808 86 Corbicula felnouilliana

GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJH 0729 75 Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJCo01 Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 JJCo01 Corbicula leana

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 HDCo03 Corbicula japonica

GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 HDCo01 Corbicula felnouilliana

GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 BSCo04 Corbicula leana

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 BSCo01 Corbicula japonica

GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 08 08 151

GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC



Ingresado el 14 de septiembre de 2021 por pintail pintail | 2 observaciones | 0 comentarios | Deja un comentario

03 de septiembre de 2021

Corbicula's COI on South Korea

I compared the COI gene in the mitochondria of Genus Corbicula with KIM, Jae-hoon and SUNG, Soo-min. Found 4 species this time in South Korea. The four species were Corbicula leana, Corbicula fluminea, Corbicula japonica, and Corbicula felnouilliana.

Please visit the page below to see their photos.
https://cafe.naver.com/yangpakor/40624
https://cafe.naver.com/yangpakor/40625

2021 BSCo01 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo02 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo04 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 HDCo01 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HDCo03 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HSCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 JJCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0729 75 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0808 86 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 92 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 93 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH Asan15 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Youngam Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo03 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo02 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTANCTNTTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 SJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 SSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
AY097287.1 Corbicula fluminalis
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGCCTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAGCTAATCCGGCCTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTGGCAGGGGCTC
JAPAN AY097314.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA AF457992.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090396.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090397.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090398.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090399.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KX192336.1 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC

Ingresado el 03 de septiembre de 2021 por pintail pintail | 0 comentarios | Deja un comentario

06 de diciembre de 2019

Sinanodonta woodiana, Anemica arcaeformis in South Korea

It was believed that Sinanodonta woodiana and Anemica arcaeformis lived in the surrounding rice fields. Anemica arcaeformis thought to be fatter than Sinanodonta woodiana.

https://cafe.naver.com/yangpakor/1999

However, recent comparisons of mtDNA show that they are all one species. And what's more confusing is not exactly what species it is.

In Korea, China, and Japan, the species Sinanodonta woodiana and Anemica arcaeformis appear to be completely different. Yes, when you look at the data on the NCBI.

https://cafe.naver.com/yangpakor/35942

Clearance of these two species is needed and research requires a record of the new species.

Ingresado el 06 de diciembre de 2019 por pintail pintail | 0 comentarios | Deja un comentario

19 de noviembre de 2018

Research on the Rana of the Korean Peninsula is very much needed.

There are three species in our country.
Rana coreana is small and easily distinguishable. However, Rana uenoi and Rana huanrenensis were recorded as similar species.

Rana uenoi lives in Jeema Island from Jeju Island to the Korean peninsula.
Rana huanrenensis inhabits the peninsula in Chinese huanren and is smaller than Rana uenoi.

These two species have been recorded in numerous scientific names since the 1930s, sometimes as a species.

Rana uenoi is still recorded as Rana dybowskii. Rana uenoi and Rana dybowskii are likely to live in North Korea. Rana dybowskii is most likely to live in northern North Korea. Rana huenrensis and smaller Rana chensinensis in North Korea

Research on the Rana of the Korean Peninsula is very much needed.

https://cafe.naver.com/yangpakor/33529
https://repository.kulib.kyoto-u.ac.jp/dspace/bitstream/2433/216901/1/zs140080.pdf
http://www.jonjfong.com/Website/Publications_files/Mol.%20Phylogenet.%20Evol.%202017%20Yang.pdf

Ingresado el 19 de noviembre de 2018 por pintail pintail | 0 comentarios | Deja un comentario

18 de noviembre de 2018

In 2018, about a quarter of the population is likely to be compared to 2008.

It is impossible to compare amphibian populations.
However, we tried to compare the population in 2008 and 2010.
We investigated the number of the same place Rana uenoi in the same place.

I feel right.
Certainly ... The population of Rana uenoi seems to be declining ...

I have done similar research in the same time period in 2016 in San Sali ....

https://cafe.naver.com/yangpakor/30240

There is not much difference from the result now.

In 2018, about a quarter of the population is likely to be compared to 2008.
In Seosan, Chungnam Province.

https://cafe.naver.com/yangpakor/33521

Ingresado el 18 de noviembre de 2018 por pintail pintail | 1 observación | 0 comentarios | Deja un comentario