Corbicula's COI on South Korea

I compared the COI gene in the mitochondria of Genus Corbicula with KIM, Jae-hoon and SUNG, Soo-min. Found 4 species this time in South Korea. The four species were Corbicula leana, Corbicula fluminea, Corbicula japonica, and Corbicula felnouilliana.

Please visit the page below to see their photos.
https://cafe.naver.com/yangpakor/40624
https://cafe.naver.com/yangpakor/40625

2021 BSCo01 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo02 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo04 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 HDCo01 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HDCo03 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HSCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 JJCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0729 75 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0808 86 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 92 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 93 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH Asan15 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Youngam Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo03 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo02 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTANCTNTTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 SJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 SSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
AY097287.1 Corbicula fluminalis
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGCCTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAGCTAATCCGGCCTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTGGCAGGGGCTC
JAPAN AY097314.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA AF457992.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090396.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090397.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090398.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090399.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KX192336.1 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC

Publicado por pintail pintail, 03 de septiembre de 2021

Comentarios

No hay comentarios todavía.

Agregar un comentario

Acceder o Crear una cuenta para agregar comentarios.