Archivos de diario de septiembre 2021

14 de septiembre de 2021

COI 266bps / Freshwater Clam / South Korea

COI 266bps / Freshwater Clam / South Korea..

https://pintail1.ivyro.net/04homepage/kongju/pintail/2021/09_September/20210919.htm



Sinanodonta schrenkii 200522 IS01

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta schrenkii 200225 21

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAAAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta schrenkii 200225 20

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCATTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta schrenckii Blue13

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGATGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTAGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta lauta Sep 18

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Sep 05

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue6

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue50

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue33

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue23

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta AS01

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGAACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGAGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 2019 02

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTGTTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 2019

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 200225 43

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTACGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 200225 31

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 1

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta cf woodiana 2 Blue40

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTAC

Sinanodonta cf woodiana 2 200225 39

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTAC

Nodularia douglasiae sk03

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae LUS02

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae JN01

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCAGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae CH01

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae Blue17

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTGGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 210729 70

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 210729 154

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGNTAATGTTGCTCATTCTGGAGCTTCTGTANATTTANCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 2019

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 200225 BYND2

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCTTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 200225 ADND3

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTGTCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia breviconcha KJ02

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGAGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha HC02

GGGAATTGACTTATTCCCTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha Blue43

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha Blue35

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha Blue32

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha Blue18

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha 210729 71

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha 2020 BS07

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCATTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha 200522 YS04

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha 200522 YS03

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha 200522 JH06

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha 200522 JH05

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

NCBI MT020521.1 Aculamprotula coreana

GGTAATTGGTTAATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTCCCTCGTTTAAATAATTTGAGGTTTTGGCTACTTGTTCCAGCTTTATTTTTGTTGTTGAGATCATCTTTAGTGGAAAGGGGTGTAGGCACTGGGTGGACAGTGTATCCGCCTTTAGCAGGAAATGTTGCTCATTCTGGAGCTTCGGTAGATTTGGCTATTTTTTCTTTACACTTAGCCGGTGCTTCGTCTATTTTGGGGGCTATTAATTTTATCTCTAC

NCBI DQ264395.1 Limnoperna fortunei

GGGAATTGGTTGATTCCATTAATAATAGGGGCAGTAGATTTGATTTTTCCACGATTGAATAATATAAGGTACTGRTTTCTTTTTTTTTCCTTAGGACTTTTTTTATTGTCTATGCATGTAGAGGGTGGAGTAGGGACTGGTTGGACAGTTTATCCTCCTTTATCTAGTTTTGATGCTCATAGAACCCCAGCAGTTGACATAGCTGCTTTATCTCTTCATTTAGCTGGTGCGTCGTCAATTGGCGGTTCGTTAAATTATATTACTAG

Lanceolaria sp MK02

GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCGTCAATTTTAGGTGCTATTAATTTTATCTCTAC

Lanceolaria sp MK01

GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC

Lanceolaria acrorrhyncha 2019

GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACTATGTATCCCCCTTTGTCAAGAAATGCTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATTTTATCTCTAC

Lamprotula seomjinensis 210729 152

GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGACATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTGTTAAGATCTTCGTTGGTAGAGAGAGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCACTCCGGGGCTTCGGTAGACTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Lamprotula leaii 2020 BS06

GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Koreosolenaia sitgyensis 210729 65

GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATTTTATTTCTAC

Koreosolenaia sitgyensis 210729 64

GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATTTTATTTCTAC

Koreosolenaia sitgyensis 2020 BS02

GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCTTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGTGCTATTAATTTTATTTCTAC

KOREA EU090399.1 Corbicula sp.

GGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

KOREA EU090397.1 Corbicula sp.

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCAC

KOREA AF457992.1 Corbicula sp.

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

Inversiunio verrucisus 2020 BS04

GGTAATTGACTTATTCCTCTGATAATTGGTGCTCCTGATATGGCTTTTCCACGATTAAACAATTTGAGTTTTTGGTTGCTTGTCCCAGCCTTGTTTTTGTTGTTAAGTTCGTCTTTGGTAGAGAGGGGTGTTGGTACTGGTTGAACAGTATATCCACCTTTGTCTGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTGGCTATTTTTTCATTACATCTTGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

HYTr Musculium lacustre

GGAAATTGATTGGTACCATTAATATTANTGGTTCCTGATATAGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTATTACCTGTTGCATTATTGTTATTGTTAGGATCAGCTTATGTAGAGAGAGGAGCTGGAACTGGGTGAACTATCTATCCCCCATTGTCTGGAAATGTAGCTCATGCTGGACCTTCAATANAATTTGCAATTTTGTCTTTACATTTAGGTGGTGCTTCATCTATTGCTGCATCAATTAATTTTTTAACTAC

Cristaria plicata 2019

GGGAATTGACTTATTCCACTAATAATTGGTGCTCCCGATATGGCTTTTCCTCGCCTAAATAACCTGAGGTTTTGATTACTTGTACCGGCATTGTTTTTACTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGGACGGTATATCCGCCCTTATCCGGAAATGTTGCTCACTCTGGGGCTTCTGTAGATTTGGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCCATTAATTTTATTTCTAC

Buldowskia shadini us23

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini Blue31

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini Blue28

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini 200225 fatSeosan2

GGAAACTGACTTATTCCTTTAATAATTGGGGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini 200225 55

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini 200225 40

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 2020 SC01

GGAAATTGACTCCTTCCTTTGATGATTGGCCCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCAGATTGCTCGTGCCCTCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAAGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCGTCTGGCTGGGGCTTCCTCAATTTTATGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 2020 KR02

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 2020 KR01

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 200225 58

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 200225 18

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia flavotincta SK06

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGGCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGGAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTATCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

Buldowskia flavotincta sk02

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

Buldowskia flavotincta SK01

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

Buldowskia flavotincta Buyeo 01

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCTCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

BSPc01 Potamocorbula amurensis

GGTAATTGATTAGTTCCTTTGATGTTAGCTGTTCCAGATATGGCGTTTGCTCGTATAAATAATTTAAGATTTTGAGTTCTTCCTTCTTCTTTTACATTAATGGGCTTTTCTCTTTTTAGTGAAGGTGGTTTTGGTGGTGGGTGAACTCTTTACCCTCCTTTATCTAGAAATATTGCTCATTCTGGTCCAGCTATAGATTTTTTAATTTTGTCTCTTCATTTAGGGGGTTTGTCGTCAATTATGGCTTCTTTGAACTTTTATAGGAC

Anemina euscaphys Black15

GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATTTTATTTCTAC

Anemina euscaphys Black14

GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGGGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATGTTAGGAGCTATTAATTTCATTTCTAC

Anemina euscaphys Black12

GGGAATTGGCTTATTCCTTTAATGATAGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACCGTTTATCCTCCTCTGTCCGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGAGCTATTAATTTTATTTCTAC

Anemina euscaphys 2020 MY01

GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATTTTATTTCTAC

Anemina arcaeformis Sep 26

GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis Blue10

GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTAGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGGTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTCCATTTGGCTGGGGCTTCTTCGATTTTAGGGGCTATTAATTTTATTTCTAC

Anemina arcaeformis Black6

GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis Black13

GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis Asan03

GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis 200522 AD21

GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC

Aculamprotula sp JJ01

GGTAATTGGTTGATTCCTATGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGGTGGAACTGGATGAACGATGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATGTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC

Aculamprotula sp 210729 69

GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC

Aculamprotula sp 210729 66

GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC

2021 SSCo01 Corbicula leana

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 Pisidium coreanum

GGAAATTGGNTANTTCCNTTGATGTTGGTTGTTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGATTGTTACCTGTTGCATTAATGTTATTATTAGGTTCTGCTTACGTTGAAAGAGGTGCTGGAACTGGTTGAACTATTTATCCNCCGTTGTCTGGGAATGTTGCTCAGGCTGGCCCTTCTNTANAGTTTGCTATTTTGTCTTTACATTTGGGTGGNGCTTCTTCTATTGCTGCATCTTTNAATTTTTTGACTAC

2021 KJH Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJH Asan15 Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJH 0808 86 Corbicula felnouilliana

GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJH 0729 75 Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJCo01 Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 JJCo01 Corbicula leana

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 HDCo03 Corbicula japonica

GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 HDCo01 Corbicula felnouilliana

GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 BSCo04 Corbicula leana

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 BSCo01 Corbicula japonica

GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 08 08 151

GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC



Ingresado el 14 de septiembre de 2021 por pintail pintail | 2 observaciones | 0 comentarios | Deja un comentario

03 de septiembre de 2021

Corbicula's COI on South Korea

I compared the COI gene in the mitochondria of Genus Corbicula with KIM, Jae-hoon and SUNG, Soo-min. Found 4 species this time in South Korea. The four species were Corbicula leana, Corbicula fluminea, Corbicula japonica, and Corbicula felnouilliana.

Please visit the page below to see their photos.
https://cafe.naver.com/yangpakor/40624
https://cafe.naver.com/yangpakor/40625

2021 BSCo01 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo02 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo04 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 HDCo01 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HDCo03 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HSCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 JJCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0729 75 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0808 86 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 92 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 93 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH Asan15 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Youngam Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo03 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo02 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTANCTNTTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 SJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 SSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
AY097287.1 Corbicula fluminalis
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGCCTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAGCTAATCCGGCCTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTGGCAGGGGCTC
JAPAN AY097314.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA AF457992.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090396.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090397.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090398.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090399.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KX192336.1 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC

Ingresado el 03 de septiembre de 2021 por pintail pintail | 0 comentarios | Deja un comentario