Ícono
Fotos / Sonidos
Especie / Nombre del taxón
Observador
Lugar
Acciones

Fotos / Sonidos

No hay fotos o sonidos

Observ.

awenninger

Fecha

Agosto 5, 2020 12:08 PM AKDT

Descripción

Sent in a leafmining moth to LifeScanner but it must have been contaminated, the ID came back as Chaitophorus populifolii. Host was balsam poplar. BOLD-DJ4, DNA sequence: COI-5P
AACTTTATATTTTTTATTCGGAATCTGATCAGGAATAATTGGATCTTCATTAAGAATTTTAATTCGATTAGAACTTAGACAAATTAATTCAATTANTAATAATAATCAATTATATAATGTTATTGTAACAATTCATGCATTTATTATAATTTTCTTTATAACAATACCTATCGTAATTGGAGGATTCGGAAATTGATTAATTCCTATAATAATAGGATGTCCTGACATATCATTTCCACGTTTAAATAATATTAGATTTTGAATATTACCACCCTCCCTAATAATAATAATTACAAGATTTATAATTAATAATGGAACAGGAACAGGATGAACAATTTATCCCCCATTATCAAATAATATTGCCCACAATAATATTTCAGTTGATCTAACTATTTTTTCATTACATTTAGCAGGAGTATCTTCTATTTTAGGAGCAATTAATTTTATTTGCACTATCTTAAATATAATACCCAATAACATAAAACTTAATCAAATCCCCCTTTTCCCTTGATCTATTTTAATTACAGCAATCTTATTAATCCTTTCATTACCTGTATTAGCAGGTGNTATTACAATACTATTAACTGATCGAAACCTAAATACTTCATTTTTCG-

Link to observation of leaf/mine from leafminer I had sent in: https://www.inaturalist.org/observations/55720746

Fotos / Sonidos

Qué

Escarabajos Taladradores de Postes Familia Bostrichidae

Observ.

awenninger

Fecha

Septiembre 17, 2020 07:22 PM AKDT

Descripción

Found in brown rice

Fotos / Sonidos

Square

Observ.

awenninger

Fecha

Junio 10, 2020 11:25 AM AKDT

Descripción

Host: Betula neoalaskana. Family ID from LifeScanner. Vial BOLD-GE8. DNA sequence: COI-5P
TATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCAGAATTAGGTAACCCTGGTTCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGCAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATACCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTCGACCCTGCAGGAATAAGA-----------------

Fotos / Sonidos

Square

Observ.

awenninger

Fecha

Junio 10, 2020 08:28 AM AKDT

Descripción

Host: Betula neoalaskana. Family ID from lifescanner. Lifescanner vial BOLD-ZR6. DNA sequence: COI-5P
GAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGGAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATACCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACATCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Fotos / Sonidos

Observ.

awenninger

Fecha

Septiembre 16, 2020 03:56 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Septiembre 16, 2020 04:35 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Septiembre 10, 2020 10:06 AM AKDT

Fotos / Sonidos

Square

Qué

Avispas Parasitoides Y Sin Aguijón Superfamilia Ichneumonoidea

Observ.

awenninger

Fecha

Septiembre 10, 2020 11:58 AM AKDT

Fotos / Sonidos

Qué

Avispas Sin Aguijón Familia Ichneumonidae

Observ.

awenninger

Fecha

Septiembre 10, 2020 11:57 AM AKDT

Fotos / Sonidos

Square

Observ.

awenninger

Fecha

Septiembre 10, 2020 12:30 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Septiembre 10, 2020 10:06 AM AKDT

Fotos / Sonidos

Qué

Mirlo Cinchado Ixoreus naevius

Observ.

awenninger

Fecha

Septiembre 10, 2020 12:07 PM AKDT

Descripción

Found dead

Fotos / Sonidos

Qué

Setas, Bejines Y Parientes Clase Agaricomycetes

Observ.

awenninger

Fecha

Septiembre 10, 2020 01:43 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Septiembre 10, 2020 01:41 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Septiembre 10, 2020 01:41 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Septiembre 10, 2020 01:13 PM AKDT

Fotos / Sonidos

Qué

Escarabajos Y Parientes Orden Coleoptera

Observ.

awenninger

Fecha

Septiembre 9, 2020 07:52 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Septiembre 9, 2020 07:54 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Septiembre 5, 2020 06:31 PM AKDT

Fotos / Sonidos

Square

Observ.

awenninger

Fecha

Agosto 31, 2020 06:12 PM AKDT

Fotos / Sonidos

Square

Observ.

awenninger

Fecha

Septiembre 1, 2020 09:26 AM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Agosto 31, 2020 07:55 PM AKDT
Birds

Fotos / Sonidos

Square

Qué

Aves Clase Aves

Observ.

awenninger

Fecha

Agosto 31, 2020 02:50 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Agosto 31, 2020 02:22 PM AKDT

Descripción

On Sitka or Siberian alder

Fotos / Sonidos

Square

Observ.

awenninger

Fecha

Agosto 31, 2020 02:09 PM AKDT

Fotos / Sonidos

Observ.

awenninger

Fecha

Agosto 31, 2020 01:34 PM AKDT

Descripción

On sitka or Siberian alder

Fotos / Sonidos

Square

Observ.

awenninger

Fecha

Septiembre 1, 2020 09:27 AM AKDT

Fotos / Sonidos

Square

Observ.

awenninger

Fecha

Septiembre 1, 2020 09:28 AM AKDT

Fotos / Sonidos

Square

Qué

Tremella Tremella mesenterica

Observ.

awenninger

Fecha

Septiembre 1, 2020 10:05 AM AKDT

Descripción

On alder

Fungi

Fotos / Sonidos

Square

Qué

Hongos Reino Fungi

Observ.

awenninger

Fecha

Septiembre 1, 2020 10:05 AM AKDT

Descripción

On alder

Fuentes:: Átomo