Fotos / Sonidos

Observ.

stevilkinevil

Fecha

Junio 23, 2015

Descripción

Additional notes for sequences (bases on the right):

ITS:

Originally posted to Mushroom Observer on Jun. 24, 2015.

Fotos / Sonidos

Observ.

pjrthe1st

Fecha

Julio 26, 2023 a las 09:17 TARDE EDT

Descripción

ITS sequence shows it's a Squamanita but there is no close match to existing records in Genbank.

The host is Amanita canescens and is a separate entry in iNaturalist (200288206)!

Fotos / Sonidos

Observ.

kmohatt

Fecha

Agosto 25, 2018 a las 06:48 MAÑANA PDT

Descripción

Cap 28-58mm across, stipe 85-104mm long, 3-7mm thick, gill edges ragged, odor faint, fruity, taste slightly bitter

Fotos / Sonidos

Observ.

annepolyakov

Fecha

Octubre 21, 2023

Descripción

Specimen 35
This mushroom was found on a mossy rock by a waterfall in a very moist microclimate

Fotos / Sonidos

Observ.

johnplischke

Fecha

Agosto 13, 2023 a las 09:47 MAÑANA EDT

Descripción

JP23-0311

Fotos / Sonidos

Observ.

corndog

Fecha

Octubre 15, 2023 a las 01:40 TARDE PDT

Fotos / Sonidos

Observ.

bit

Fecha

Abril 14, 2024 a las 10:48 MAÑANA PDT

Descripción

Pisgah 2019 fire. On the underside of a big burnt oak log

Etiquetas

Fotos / Sonidos

Observ.

thomasroehl

Fecha

Septiembre 29, 2021 a las 09:52 MAÑANA CDT

Descripción

Large for the species: heads ~6 cm across, rays ~10 cm across. Not collected by me, but I got the approximate location of where it was found.

Fotos / Sonidos

Observ.

thomasroehl

Fecha

Abril 17, 2021 a las 01:11 TARDE UTC

Descripción

Growing on and deforming gills of Flammulina velutipes. Colony white and fluffy on PDA, producing thallic conidia. In culture, producing thick bundles of mycelium.

Fotos / Sonidos

Fecha

Diciembre 2023

Descripción

Rabbit dung. @werdnus have you ever seen something like this? F000208

Fotos / Sonidos

Qué

Escobetillas (Género Ramaria)

Observ.

ninamp

Fecha

Mayo 26, 2018 a las 10:56 MAÑANA AEST

Descripción

By Sella River along trail.

Fotos / Sonidos

Observ.

zia_crytser

Fecha

Mayo 19, 2022 a las 11:54 MAÑANA ChST

Fotos / Sonidos

Observ.

mgkoons

Fecha

Diciembre 17, 2023 a las 12:26 TARDE PST

Descripción

On 150+ year old Thuja plicata, KOH reaction red, red-orange (pictured in close up of collection)

Pores .75-1 per cm, with white sebiculum, microscopy pending

Fotos / Sonidos

Fecha

Agosto 31, 2012

Descripción

The cap has an interesting crunchy texture.

Growing on well decayed wood.

Spores smooth, inequilateral, 10.5 – 13 × 5 – 6.5 µm, with 1 or 2 oil droplets per spore. 8 spores per ascus. Asci walls invisible in KOH.

Spore measurements:

10.6 [11.4 ; 12] 12.8 × 4.8 [5.5 ; 6] 6.6 µm

Q = 1.7 [2 ; 2.2] 2.4 ; N = 15 ; C = 95%

Me = 11.7 × 5.7 µm ; Qe = 2.1

Fotos / Sonidos

Observ.

magpie_anomica

Fecha

Octubre 2, 2023 a las 10:51 MAÑANA EDT

Fotos / Sonidos

Observ.

wildwestnature

Fecha

Marzo 2, 2024 a las 11:05 MAÑANA CST

Descripción

Sand prairie

Fotos / Sonidos

Observ.

corndog

Fecha

Noviembre 6, 2021 a las 03:47 TARDE PDT

Fotos / Sonidos

Observ.

lostcoastmike

Fecha

Diciembre 15, 2023 a las 01:11 TARDE PST

Descripción

Spores 4-4.5 x 2.2-3 µm.
On a huge standing dead Madrone. Does not key out. Some obscure polypore. . . .
Small pores 2-3/mm.
Trametes-like, but no hair and spores are quite different.

Fotos / Sonidos

Qué

Setas, Bejines Y Parientes (Clase Agaricomycetes)

Observ.

true_islander

Fecha

Diciembre 18, 2023 a las 02:17 TARDE PST

Descripción

Growing on salad branch.

Fotos / Sonidos

Observ.

chael

Fecha

Octubre 30, 2017

Fotos / Sonidos

Observ.

corndog

Fecha

Octubre 1, 2022 a las 11:02 MAÑANA PDT

Fotos / Sonidos

Observ.

cizon77

Fecha

Octubre 9, 2019

Descripción

Cuphophyllus #930
Photo#2 - pileipellis

Caps - 2 1/2 - 5 1/3 cm wide, convex to plane with irregular margins and some with sunken discs. Viscid at first, matte when dry. Tan becoming pale brown at disc. Randomely pock-marked.
Gills - Decurrent, arcuate, waxy,subdistant. Buff with a faint pale orenge tinge when observed sideways. Four tiers of lamellulae. Edges entire.
Stipe - 3-4 cm long and 7-9 mm thick. Canescent buff pruina on a watery tan ground. Base clavate.
Some white velar material at base. White canescent line at apex.
Odor & Taste - Mild.
Spores - White, inamyloid.
Habitat - Scattered under alder at Geneva Lake at the Stimpson Family Reserve on October 9, 2019.
Spores - Ellipsoid in face view, slightly dacryoid in profile. 7-9 x 4-5 microns. One large pale gray-blue oil drop in most. Q = 1.89.
Basidia - Clavate, 2 and 4-spored. 25-31 x 7-8 microns.
Gill Trama - Of interwoven hyphae.
Clamps - Present in pileipellis, stipitipellis, bases of basidia, and gill trama.
Pileipellis - Of interwoven hyphae 2-4 microns wide.
Pileal trama - Of radially parallel hyphae 4-10 microns wide.
Oleiferous hyphae - Present in stipitipellis.
Stipitipellis - Of vertical hyphae 3-10 microns wide.
Caulocystidia - Nests of branched and filiform hyphae with golf club (subcapitate) apices. 3-5 microns wide.
Comment - Close to Cuphophyllus borealis which differs by having a cutis of radially parallel hyphae for a pileipellis.

Fotos / Sonidos

Observ.

jackjohnsonn

Fecha

Septiembre 15, 2023 a las 12:12 TARDE PDT

Descripción

Peat dwelling small yellow Clavaria. Maybe something close to the description of C. argillacea. Fruitbodies ~.8-2cm
No color reaction in short wave UV.

Etiquetas

Fotos / Sonidos

Observ.

ben_ertle

Fecha

Noviembre 24, 2023 a las 01:34 TARDE HST

Fotos / Sonidos

Observ.

mycoscope

Fecha

Mayo 4, 1996

Descripción

In rainforest

Fotos / Sonidos

Observ.

johnplischke

Fecha

Septiembre 6, 2010

Fotos / Sonidos

Observ.

brucen

Fecha

Enero 18, 2020 a las 03:07 TARDE PST

Descripción

Put on top of a stick for photos. Grew on the side of a conifer.

Fotos / Sonidos

Observ.

mgkoons

Fecha

Septiembre 17, 2023 a las 12:49 TARDE PDT

Descripción

Non-bluing Hymenogastraceae growing on wood in a dry stream bottom primarily with Salix and Alnus

Fotos / Sonidos

Observ.

leptonia

Fecha

Septiembre 11, 2020 a las 08:50 MAÑANA PDT

Fotos / Sonidos

Observ.

melodydodderer

Fecha

Octubre 10, 2022 a las 11:23 MAÑANA PDT

Fotos / Sonidos

Qué

Rebozuelos, Hongos Coral Y Afines (Orden Cantharellales)

Observ.

canyonus

Fecha

Diciembre 18, 2020 a las 10:32 MAÑANA PST

Fotos / Sonidos

Qué

Hongos de Repisa (Orden Polyporales)

Observ.

stelcook22

Fecha

Junio 16, 2023 a las 04:14 TARDE PDT

Descripción

bracket fungi growing on dead snag near fragrance lake in WA, mostly white with colorful gooze coming out of it

Fotos / Sonidos

Qué

Hongos Bonete (Género Mycena)

Observ.

taraseverns

Fecha

Julio 29, 2023 a las 11:07 MAÑANA HST

Fotos / Sonidos

Observ.

cuevo

Fecha

Junio 19, 2023 a las 12:51 TARDE PDT

Descripción

Fungus Fruiting. Growing in bark mulch.

Fotos / Sonidos

Observ.

lizziepop

Fecha

Enero 27, 2022 a las 09:23 MAÑANA SAST

Fotos / Sonidos

Observ.

davidascanio

Fecha

Octubre 20, 2022 a las 01:49 TARDE -04

Fotos / Sonidos

Observ.

lauren_re

Fecha

Octubre 21, 2018 a las 01:34 TARDE PDT

Descripción

The rare Purple Powdered Fume Cap

Fotos / Sonidos

Observ.

bellaormseth

Fecha

Junio 12, 2023 a las 12:05 TARDE PDT

Descripción

This weird thing reminded me or orchid roots or some sort of finger fungus. It seemed to be growing from Vaccinium parvifolium, the red huckleberry. Found in a second growth conifer forest.

Fotos / Sonidos

Observ.

betweenthelyons

Fecha

Mayo 2023

Descripción

K-, slightly sweet scent, Doug fir

Fotos / Sonidos

Observ.

rudydiaz

Fecha

Mayo 2023

Descripción

High elevation chaparral and mixed forest, Pseudotsuga macrocarpa, Pinus ponderosa, Quercus chrysolepis, Hesperoyucca whipplei.
Growing on leaves and twigs submerged underwater ~4 in deep in mildly turbulent stream from snowmelt runoff. Area had been covered in snow two weeks previously, but it was absent at the time of the observation, with last traces visible in between peaks at the highest elevation.

Most caps clearly developing and expanding underwater; others starting above water out of saturated margins of the stream. “Aquatic” caps bursting through layer of algae on surface of the water, but no algae on the underwater substrate.

Underwater caps alabaster at button stages, expanding to brown with white cracked pattern. Above-water caps more dome-shaped, velvety, zonate. Both hygrophanous. Gill margins white; consistent feature.
Stipe lacking annulus, extraordinary flexible for Psathyrella. Rigid inner layer (revealed by microscopy to be a dark conglutination) and a squishy, plastic-bag-like outer layer (consisting of lighter hyphae in pyramidal ridges).

Spores deposit purple black.
Spores cigar brown. KOH+ fuscous. With apical pores. [11.8] 12.25-13.18 [13.9] x [6.2] 6.62-7.2 7[7.8] μm
Q [1.71] 1.74-1.89[2]

Spores measured from spore print deposited from mushroom cap that developed underwater; evidence for this is the presence of diatoms in the cross section of this mushroom.

On this same cross section are spores that appear to have germinated on the gills.

Fotos / Sonidos

Observ.

corndog

Fecha

Abril 17, 2023 a las 03:21 TARDE PDT

Descripción

On raised sphagnum hummocks in poor fen. Fruiting bodies 1-2 cm

Spores globose, 10microns

Fotos / Sonidos

Observ.

rosawoodsii

Fecha

Enero 2022

Lugar

Oregon, US (Google, OSM)

Descripción

Dog-found in the Holiday Farm Fire burn area (burned in Sept 2020). Douglas fir forest with a few incense-cedars. Burn low to moderate severity. Spores larger than an Oregon black truffle's spores and refuse to squash free from the flesh. White latex when cut. Fruit body was very firm/dense.

Fotos / Sonidos

Observ.

abe

Fecha

Septiembre 13, 2014 a las 04:08 TARDE PDT

Fotos / Sonidos

Observ.

rudydiaz

Fecha

Marzo 3, 2023 a las 02:48 TARDE PST

Descripción

Cap cream, convex to plane. Gills clitocyboid. Young specimens with vellipellis. Odor farinaceous. Growing on dead live oak.

Fotos / Sonidos

Qué

Hongos Quitridios (Filo Chytridiomycota)

Observ.

leptonia

Fecha

Abril 2, 2023 a las 03:29 TARDE PDT

Descripción

maybe?? On Blennosperma

Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Observ.

harsiparker

Fecha

Marzo 1, 2023 a las 12:55 TARDE PST

Descripción

~1 mm growths attached to dangling dead portions of a Salmonberry stem. I checked back on these a few weeks later and they remained unchanged in appearance. Currently stumped as to where to even start in narrowing down the ID -- any and all ideas would be awesome!

Etiquetas

Fotos / Sonidos

Observ.

giulioz

Fecha

Febrero 6, 2023 a las 04:33 TARDE -05

Descripción

???

Fotos / Sonidos

Fecha

Enero 30, 2022 a las 04:31 TARDE PST

Fotos / Sonidos

Qué

Hongos de Repisa (Género Ganoderma)

Observ.

suillusjoe

Fecha

Abril 12, 2020 a las 01:09 TARDE HST

Descripción

Occurring on old Ohia(Metrosideros p.)stump, native forest. Multiple fruiting bodies in various stages. Quickly staining brown with touch/pressure. Location approximate, no microscopic data.

Fotos / Sonidos

Qué

Setas, Bejines Y Parientes (Clase Agaricomycetes)

Observ.

arielbonkoski

Fecha

Noviembre 15, 2022 a las 12:52 TARDE CST

Descripción

On cedar

Fotos / Sonidos

Observ.

christrent

Fecha

Diciembre 2022

Fotos / Sonidos

Observ.

crabsandshrimps

Fecha

Julio 30, 2017 a las 11:29 TARDE PDT

Fotos / Sonidos

Observ.

corndog

Fecha

Octubre 8, 2022 a las 11:54 MAÑANA PDT

Descripción

/Marasmiaceae. Tough fruiting bodies, thickened stipe apex, on wood, odorless

Fotos / Sonidos

Observ.

johnplischke

Fecha

Septiembre 23, 2022 a las 08:16 MAÑANA EDT

Fotos / Sonidos

Observ.

chyroptera

Fecha

Febrero 20, 2023 a las 02:49 TARDE PST

Descripción

On old stem of nettles (Urtica sp.)

Fotos / Sonidos

Observ.

else

Fecha

Enero 14, 2022 a las 11:41 MAÑANA PST

Descripción

on bark of living Quercus kellogii.
first three photos by @milavth

Fotos / Sonidos

Observ.

ym_wang_pnw

Fecha

Enero 16, 2023 a las 01:54 TARDE PST

Fotos / Sonidos

Observ.

heavykevy13

Fecha

Febrero 18, 2023 a las 12:53 TARDE EST

Fotos / Sonidos

Observ.

michele36

Fecha

Enero 2023

Fotos / Sonidos

Observ.

corndog

Fecha

Octubre 2, 2022 a las 06:49 TARDE PDT

Descripción

Strange one, I thought it was Tubaria..

on soil, with alder, blue under UV. collected

Fotos / Sonidos

Observ.

corndog

Fecha

Octubre 2, 2022 a las 04:28 TARDE PDT

Descripción

on sedges in fen

Fotos / Sonidos

Observ.

dannymi

Fecha

Julio 28, 2016

Descripción

Photo and collection by Andrew Parker. On conifer litter.

Fotos / Sonidos

Observ.

autumna

Fecha

Noviembre 15, 2020 a las 01:48 TARDE PST

Descripción

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

Fotos / Sonidos

Qué

Setas, Royas Y Tizones (Filo Basidiomycota)

Observ.

jackjohnsonn

Fecha

Noviembre 18, 2021 a las 11:22 MAÑANA PST

Fotos / Sonidos

Fecha

Enero 14, 2023 a las 11:54 MAÑANA PST

Descripción

Grows loosely attached to bark on living Quercus garryana. Hymenium lacks pores but looks finely granular probably due to very large basidia (up to 50 microns beyond rest of hymenium and long sterigmata (10-20 microns long. Spores are amyloid, roughened, thick-walled with refractive content, average 15.9 x13.8 microns. They have a small pip. Another possibility is Aleurocystidiellum. No good species match.

Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Observ.

lumenal

Fecha

Enero 23, 2023 a las 10:57 MAÑANA PST

Descripción

Lichenicolous fungi on Parmelia

Fotos / Sonidos

Observ.

lumenal

Fecha

Enero 23, 2023 a las 11:00 MAÑANA PST

Descripción

Lichenicolous fungi on Evernia prunastri

Fotos / Sonidos

Observ.

corndog

Fecha

Enero 21, 2023 a las 09:48 TARDE PST

Descripción

On dunegrass

Fotos / Sonidos

Observ.

sadie_hickey

Fecha

Octubre 23, 2019

Fotos / Sonidos

Observ.

tropicmycoprof

Fecha

Septiembre 11, 2021 a las 06:19 TARDE HST

Fotos / Sonidos

Observ.

suillusjoe

Fecha

Enero 23, 2022 a las 10:52 MAÑANA HST

Descripción

Growing out of mango wood chips, gregarious,

Gills: free crowded, butter colored. Lamellulea: 3 series
Stipe: hollow, tapering upward from sub-bulbous squamulous base, stipe staining readily reddish orange and fading to grey brown.

Annulus present.

Cap: 15-70mm convex to pano convex, white with brown/Black concentric scales/dots radiating from central broadly mammillate apex. Margin crenulate/wavy and semi striate.

Odor: fungal with light smell of anise
Taste: mild/none

Fotos / Sonidos

Qué

Setas, Royas Y Tizones (Filo Basidiomycota)

Observ.

aespinosa21

Fecha

Octubre 22, 2022 a las 09:22 MAÑANA HST

Descripción

ID?

Fotos / Sonidos

Observ.

taraseverns

Fecha

Diciembre 28, 2022 a las 11:02 MAÑANA HST

Descripción

Maunawili Ditch Trail.

Fotos / Sonidos

Qué

Hongo Costra Púrpura (Punctularia atropurpurascens)

Observ.

taraseverns

Fecha

Diciembre 29, 2022 a las 11:13 MAÑANA HST

Fotos / Sonidos

Observ.

fmr

Fecha

Marzo 13, 2015 a las 03:01 TARDE PDT

Descripción

Photo 2 - spiral-form caulocystidia

Fotos / Sonidos

Observ.

jackielo77

Fecha

Octubre 30, 2022 a las 05:03 TARDE PDT

Fotos / Sonidos

Observ.

adrichandler

Fecha

Octubre 31, 2020 a las 11:16 MAÑANA PDT

Fotos / Sonidos

Observ.

harsiparker

Fecha

Junio 23, 2018 a las 12:25 TARDE PDT

Descripción

This observation is for the fungi.

Western Thatching Ant (Formica obscuripes) clinging to grass stem, with unknown entomopathogenic fungi. The two springtails are Entomobrya triangularis and appeared to be eating either the ant, the fungi, or both. Photos of the same ant one day earlier (with abdomen still intact) are here:
https://www.inaturalist.org/observations/99149670

Observation for the ant is here:
https://www.inaturalist.org/observations/99151521

Observation for the springtails is here:
https://www.inaturalist.org/observations/99151881

Fotos / Sonidos

Observ.

brettjackson

Fecha

Octubre 25, 2021 a las 03:51 TARDE CDT

Descripción

Amazing how something so distinctive can be so difficult to identify. On dead Thuja plicata I believe.

Fotos / Sonidos

Observ.

brettjackson

Fecha

Octubre 25, 2021 a las 04:58 TARDE CDT

Descripción

Growing on Corylus cornuta. There seem to be quite a few genera in Sordariomycetes that have orange conidiomata. Allantoporthe decedens is also possible.

Fotos / Sonidos

Observ.

nudge9

Fecha

Diciembre 16, 2022 a las 02:42 TARDE PST

Descripción

Third time I have seen this at work this month! Always on alder!

spores: light or white. images 2,3 are dry but fresh (know that's myco-sinning!!) Image 4 is in water.

Fotos / Sonidos

Fecha

Enero 27, 2018

Descripción

Funny plastic like odor. Found by pdvmushroom, see https://www.inaturalist.org/observations/9640562

Fotos / Sonidos

Observ.

damontighe

Fecha

Noviembre 14, 2016 a las 12:30 TARDE PST

Descripción

??? There was 3 Amanita in the vicinity of the oak. 1 had traditional A. phalloides coloring

Fotos / Sonidos

Qué

Hongo de la Muerte (Amanita phalloides)

Observ.

jwhunt

Fecha

Noviembre 7, 2021 a las 11:39 MAÑANA UTC

Fotos / Sonidos

Observ.

wildmacro

Fecha

Junio 22, 2019 a las 03:00 TARDE PDT

Descripción

Gall with exit hole on huckleberry oak (Quercus vacciniifolia).

Fotos / Sonidos

Observ.

mgkoons

Fecha

Noviembre 20, 2022 a las 12:50 TARDE PST

Fotos / Sonidos

Observ.

ym_wang_pnw

Fecha

Octubre 26, 2022 a las 01:32 TARDE PDT

Fotos / Sonidos

Observ.

ym_wang_pnw

Fecha

Junio 14, 2022 a las 05:09 TARDE PDT

Descripción

Seems to turn green in KOH

Etiquetas

Fotos / Sonidos

Observ.

betweenthelyons

Fecha

Junio 29, 2022 a las 11:27 MAÑANA PDT

Descripción

Smut fungus on anthers of Silene lemmonii. Last photo shows comparison to normal flower

Fotos / Sonidos

Observ.

rachel_swenie

Fecha

Julio 30, 2022 a las 02:01 TARDE EDT

Descripción

On heavily decayed hardwood log

Fotos / Sonidos

Observ.

clm98043

Fecha

Septiembre 16, 2022 a las 03:35 TARDE PDT

Fotos / Sonidos

Fecha

Septiembre 18, 2022

Descripción

🍄

Fotos / Sonidos

Observ.

jackjohnsonn

Fecha

Julio 19, 2022 a las 08:09 TARDE EDT

Descripción

Solitary on the ground in litter under mixed hardwood forest of Acer, Quercus, sycamore, Carya, even some Juniper.
Somewhat tough, orange fuzzy base at stipe. No distinct odor. Photos are poor due to thunderstorms.

Fotos / Sonidos

Qué

Perrito Llanero de Gunnison (Cynomys gunnisoni)

Observ.

brian35

Fecha

Septiembre 11, 2022 a las 01:45 TARDE MDT

Descripción

White

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Observ.

scooby_runner

Fecha

Junio 13, 2022 a las 06:39 TARDE PDT

Fotos / Sonidos

Observ.

royh

Fecha

Agosto 10, 2022

Descripción

Pileus cantharelloid in outline, up to 3 cm broad, dry, dull brownish pink. Flesh white, unchanging with bubble gum-like odor. Lamellae decurrent, forked, white to pinkish white, uncahnging. Stipe very short, up to 1 cm long, up to 1 cm broad, tapered downward from apex, dry, pinkish white.

Fotos / Sonidos

Observ.

noah_siegel

Fecha

Octubre 17, 2020 a las 09:15 MAÑANA PDT