Fotos / Sonidos

Fecha

Enero 30, 2022 a las 04:31 TARDE PST

Fotos / Sonidos

Qué

Hongos de Repisa (Género Ganoderma)

Observ.

suillusjoe

Fecha

Abril 12, 2020 a las 01:09 TARDE HST

Descripción

Occurring on old Ohia(Metrosideros p.)stump, native forest. Multiple fruiting bodies in various stages. Quickly staining brown with touch/pressure. Location approximate, no microscopic data.

Fotos / Sonidos

Qué

Setas, Bejines Y Parientes (Clase Agaricomycetes)

Observ.

arielbonkoski

Fecha

Noviembre 15, 2022 a las 12:52 TARDE CST

Descripción

On cedar

Fotos / Sonidos

Observ.

christrent

Fecha

Diciembre 2022

Fotos / Sonidos

Observ.

crabsandshrimps

Fecha

Julio 30, 2017 a las 11:29 TARDE PDT

Fotos / Sonidos

Observ.

corndog

Fecha

Octubre 8, 2022 a las 11:54 MAÑANA PDT

Descripción

/Marasmiaceae. Tough fruiting bodies, thickened stipe apex, on wood, odorless

Fotos / Sonidos

Observ.

johnplischke

Fecha

Septiembre 23, 2022 a las 08:16 MAÑANA EDT

Fotos / Sonidos

Observ.

chyroptera

Fecha

Febrero 20, 2023 a las 02:49 TARDE PST

Descripción

On old stem of nettles (Urtica sp.)

Fotos / Sonidos

Observ.

else

Fecha

Enero 14, 2022 a las 11:41 MAÑANA PST

Descripción

on bark of living Quercus kellogii.
first three photos by @milavth

Fotos / Sonidos

Observ.

ym_wang_pnw

Fecha

Enero 16, 2023 a las 01:54 TARDE PST

Fotos / Sonidos

Observ.

heavykevy13

Fecha

Febrero 18, 2023 a las 12:53 TARDE EST

Fotos / Sonidos

Observ.

michele36

Fecha

Enero 2023

Fotos / Sonidos

Observ.

corndog

Fecha

Octubre 2, 2022 a las 06:49 TARDE PDT

Descripción

Strange one, I thought it was Tubaria..

on soil, with alder, blue under UV. collected

Fotos / Sonidos

Observ.

corndog

Fecha

Octubre 2, 2022 a las 04:28 TARDE PDT

Descripción

on sedges in fen

Fotos / Sonidos

Observ.

dannymi

Fecha

Julio 28, 2016

Descripción

Photo and collection by Andrew Parker. On conifer litter.

Fotos / Sonidos

Observ.

autumna

Fecha

Noviembre 15, 2020 a las 01:48 TARDE PST

Descripción

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

Fotos / Sonidos

Qué

Setas, Royas Y Tizones (Filo Basidiomycota)

Observ.

jackjohnsonn

Fecha

Noviembre 18, 2021 a las 11:22 MAÑANA PST

Fotos / Sonidos

Fecha

Enero 14, 2023 a las 11:54 MAÑANA PST

Descripción

Grows loosely attached to bark on living Quercus garryana. Hymenium lacks pores but looks finely granular probably due to very large basidia (up to 50 microns beyond rest of hymenium and long sterigmata (10-20 microns long. Spores are amyloid, roughened, thick-walled with refractive content, average 15.9 x13.8 microns. They have a small pip. Another possibility is Aleurocystidiellum. No good species match.

Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Observ.

lumenal

Fecha

Enero 23, 2023 a las 10:57 MAÑANA PST

Descripción

Lichenicolous fungi on Parmelia

Fotos / Sonidos

Observ.

lumenal

Fecha

Enero 23, 2023 a las 11:00 MAÑANA PST

Descripción

Lichenicolous fungi on Evernia prunastri

Fotos / Sonidos

Observ.

corndog

Fecha

Enero 21, 2023 a las 09:48 TARDE PST

Descripción

On dunegrass

Fotos / Sonidos

Observ.

luca_hickey

Fecha

Octubre 23, 2019

Fotos / Sonidos

Observ.

tropicmycoprof

Fecha

Septiembre 11, 2021 a las 06:19 TARDE HST

Fotos / Sonidos

Observ.

suillusjoe

Fecha

Enero 23, 2022 a las 10:52 MAÑANA HST

Descripción

Growing out of mango wood chips, gregarious,

Gills: free crowded, butter colored. Lamellulea: 3 series
Stipe: hollow, tapering upward from sub-bulbous squamulous base, stipe staining readily reddish orange and fading to grey brown.

Annulus present.

Cap: 15-70mm convex to pano convex, white with brown/Black concentric scales/dots radiating from central broadly mammillate apex. Margin crenulate/wavy and semi striate.

Odor: fungal with light smell of anise
Taste: mild/none

Fotos / Sonidos

Qué

Setas, Royas Y Tizones (Filo Basidiomycota)

Observ.

aespinosa21

Fecha

Octubre 22, 2022 a las 09:22 MAÑANA HST

Descripción

ID?

Fotos / Sonidos

Observ.

taraseverns

Fecha

Diciembre 28, 2022 a las 11:02 MAÑANA HST

Descripción

Maunawili Ditch Trail.

Fotos / Sonidos

Observ.

taraseverns

Fecha

Diciembre 29, 2022 a las 11:13 MAÑANA HST

Fotos / Sonidos

Observ.

fmr

Fecha

Marzo 13, 2015 a las 03:01 TARDE PDT

Descripción

Photo 2 - spiral-form caulocystidia

Fotos / Sonidos

Observ.

jackielo77

Fecha

Octubre 30, 2022 a las 05:03 TARDE PDT

Fotos / Sonidos

Observ.

adrichandler

Fecha

Octubre 31, 2020 a las 11:16 MAÑANA PDT

Fotos / Sonidos

Observ.

harsiparker

Fecha

Junio 23, 2018 a las 12:25 TARDE PDT

Descripción

This observation is for the fungi.

Western Thatching Ant (Formica obscuripes) clinging to grass stem, with unknown entomopathogenic fungi. The two springtails are Entomobrya triangularis and appeared to be eating either the ant, the fungi, or both. Photos of the same ant one day earlier (with abdomen still intact) are here:
https://www.inaturalist.org/observations/99149670

Observation for the ant is here:
https://www.inaturalist.org/observations/99151521

Observation for the springtails is here:
https://www.inaturalist.org/observations/99151881

Fotos / Sonidos

Observ.

brettjackson

Fecha

Octubre 25, 2021 a las 03:51 TARDE CDT

Descripción

Amazing how something so distinctive can be so difficult to identify. On dead Thuja plicata I believe.

Fotos / Sonidos

Observ.

brettjackson

Fecha

Octubre 25, 2021 a las 04:58 TARDE CDT

Descripción

Growing on Corylus cornuta. There seem to be quite a few genera in Sordariomycetes that have orange conidiomata. Allantoporthe decedens is also possible.

Fotos / Sonidos

Observ.

nudge9

Fecha

Diciembre 16, 2022 a las 02:42 TARDE PST

Descripción

Third time I have seen this at work this month! Always on alder!

spores: light or white. images 2,3 are dry but fresh (know that's myco-sinning!!) Image 4 is in water.

Fotos / Sonidos

Fecha

Enero 27, 2018

Descripción

Funny plastic like odor. Found by pdvmushroom, see https://www.inaturalist.org/observations/9640562

Fotos / Sonidos

Observ.

damontighe

Fecha

Noviembre 14, 2016 a las 12:30 TARDE PST

Descripción

??? There was 3 Amanita in the vicinity of the oak. 1 had traditional A. phalloides coloring

Fotos / Sonidos

Observ.

jwhunt

Fecha

Noviembre 7, 2021 a las 11:39 MAÑANA UTC

Fotos / Sonidos

Observ.

wildmacro

Fecha

Junio 22, 2019 a las 03:00 TARDE PDT

Descripción

Gall with exit hole on huckleberry oak (Quercus vacciniifolia).

Fotos / Sonidos

Observ.

mgkoons

Fecha

Noviembre 20, 2022 a las 12:50 TARDE PST

Fotos / Sonidos

Observ.

ym_wang_pnw

Fecha

Octubre 26, 2022 a las 01:32 TARDE PDT

Fotos / Sonidos

Observ.

ym_wang_pnw

Fecha

Junio 14, 2022 a las 05:09 TARDE PDT

Descripción

Seems to turn green in KOH

Fotos / Sonidos

Observ.

betweenthelyons

Fecha

Junio 29, 2022 a las 11:27 MAÑANA PDT

Descripción

Smut fungus on anthers of Silene lemmonii. Last photo shows comparison to normal flower

Fotos / Sonidos

Observ.

rachel_swenie

Fecha

Julio 30, 2022 a las 02:01 TARDE EDT

Descripción

On heavily decayed hardwood log

Fotos / Sonidos

Observ.

clm98043

Fecha

Septiembre 16, 2022 a las 03:35 TARDE PDT

Fotos / Sonidos

Observ.

jackjohnsonn

Fecha

Julio 19, 2022 a las 08:09 TARDE EDT

Descripción

Solitary on the ground in litter under mixed hardwood forest of Acer, Quercus, sycamore, Carya, even some Juniper.
Somewhat tough, orange fuzzy base at stipe. No distinct odor. Photos are poor due to thunderstorms.

Fotos / Sonidos

Qué

Perrito Llanero de Gunnison (Cynomys gunnisoni)

Observ.

brian35

Fecha

Septiembre 11, 2022 a las 01:45 TARDE MDT

Descripción

White

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Observ.

jonathanbolha

Fecha

Junio 13, 2022 a las 06:39 TARDE PDT

Fotos / Sonidos

Observ.

royh

Fecha

Agosto 10, 2022

Descripción

Pileus cantharelloid in outline, up to 3 cm broad, dry, dull brownish pink. Flesh white, unchanging with bubble gum-like odor. Lamellae decurrent, forked, white to pinkish white, uncahnging. Stipe very short, up to 1 cm long, up to 1 cm broad, tapered downward from apex, dry, pinkish white.

Fotos / Sonidos

Observ.

noah_siegel

Fecha

Octubre 17, 2020 a las 09:15 MAÑANA PDT

Fotos / Sonidos

Fecha

Julio 3, 2022 a las 06:16 TARDE PDT

Fotos / Sonidos

Qué

Hongos Anacates (Género Cantharellus)

Observ.

jackjohnsonn

Fecha

Julio 9, 2022 a las 12:35 TARDE EDT

Descripción

Small fruits numbering in the dozens in the sand. No more than 5m long, 1.5cm wide.

Etiquetas

Fotos / Sonidos

Observ.

aldendirks

Fecha

Octubre 17, 2021 a las 10:52 MAÑANA EDT

Fotos / Sonidos

Fecha

Octubre 15, 2013 a las 02:41 TARDE PDT

Descripción

Genus confirmed by DNA analysis (Scott Redhead). Unique species on two adjacent small oak stumps

Fotos / Sonidos

Observ.

ertmann

Fecha

Julio 26, 2022 a las 05:38 TARDE PDT

Descripción

I am an avid mushroom forager, so one of my coworkers brought this specimen into work to ask me what it was that his dog had been digging up in his backyard in South Lake Tahoe.

I brought it home and found that it wasn't in any of my ID books so I posted online on a Facebook group to see if anyone knew what it was.

The following day, while I was at work, I saw that several people thought it was Lactarius rubriviridus, a rare species. I called my girlfriend to tell her, and she told me that our dog had taken it off of the counter and chewed it into pieces.

So, it was both discovered and destroyed by dogs.

My coworker told me that his dog digs them up all the time, but since then he has brought about 10 specimens to me, none of which have been rubriviridus.

I have what is left of the specimen dried in a ziplock bag, but it's a very small amount.

Note: The location on inaturalist is the correct general neighborhood but not precise. The property owner doesn't want the location online. He is continuing to bring me samples, maybe his dog will find another one.

Fotos / Sonidos

Observ.

craigahoover

Fecha

Junio 21, 2017 a las 01:27 MAÑANA PDT

Descripción

Two Halgerda terramtuentis were located on coral reef wall at a depth of approximately 30 feet. Sizes were not measured. Water temperature was 74 degrees F.

Fotos / Sonidos

Observ.

craigahoover

Fecha

Julio 17, 2012 a las 11:28 MAÑANA PDT

Descripción

Ardeadoris scottjohnsoni was located on reef at a depth between 20-100 feet. Length was not measured. Water temperature was 73 degrees F.

Etiquetas

Fotos / Sonidos

Observ.

craigahoover

Fecha

Julio 17, 2012 a las 01:27 TARDE PDT

Descripción

Phyllidiella rosans was located on reef at a depth between 20-30 feet. Length was not measured. Water temperature was 73 degrees F.

Etiquetas

Fotos / Sonidos

Observ.

craigahoover

Fecha

Julio 17, 2012 a las 12:02 TARDE PDT

Descripción

Tambja morosa was located on reef at a depth between 20-30 feet. Length was not measured. Water temperature was 73 degrees F.

Etiquetas

Fotos / Sonidos

Observ.

corndog

Fecha

Enero 2021

Lugar

Oregon, US (Google, OSM)

Descripción

Growing on old Fomitopsis mounceae (I think). Found in a heavily managed forest, between clearcuts.

Fotos / Sonidos

Observ.

mgkoons

Fecha

Enero 2021

Descripción

or Antrodiella semisupina

Fotos / Sonidos

Observ.

begarcia

Fecha

Febrero 2021

Descripción

Found on a well decayed conifer log. Fomitopsis present nearby. Specimens <1cm wide

Fotos / Sonidos

Observ.

lauren_re

Fecha

Enero 2020

Descripción

Growing on an old Fomitopsis fruiting body

Fotos / Sonidos

Observ.

mgkoons

Fecha

Marzo 2021

Fotos / Sonidos

Observ.

natvik

Fecha

Agosto 15, 2019

Descripción

Small waxcap with yellow cap and yellow decurrecnt gills - and a 'soft red' stipe.

Fotos / Sonidos

Fecha

Marzo 8, 2020 a las 04:46 TARDE PDT

Fotos / Sonidos

Fecha

Marzo 8, 2020 a las 03:36 TARDE PDT

Descripción

No odor

Fotos / Sonidos

Observ.

kalistabanshee

Fecha

Marzo 8, 2020

Fotos / Sonidos

Observ.

julienpometta

Fecha

Febrero 5, 2021 a las 12:39 TARDE UTC

Descripción

Under redwood patch, everywhere in the duff, hundreds

Fotos / Sonidos

Observ.

julienpometta

Fecha

Febrero 13, 2021 a las 05:22 TARDE UTC

Descripción

Only found near redwoods in burned patches. Thousands of them. Stringy stipe, non-attached gills, have a "root" like redwood rooters, Dirty & dark brown/blackish caps. Pure white stipe. Minimal bruising, but develops into a dirty white/brown colored stipe in age.

Fotos / Sonidos

Observ.

matt167

Fecha

Octubre 24, 2021 a las 08:19 TARDE UTC

Fotos / Sonidos

Observ.

simon994

Fecha

Junio 5, 2022 a las 02:26 TARDE PDT

Fotos / Sonidos

Observ.

tyson_ehlers

Fecha

Julio 5, 2020 a las 01:33 TARDE PDT

Descripción

deep duff under cedar and hemlock in a moist shady site

Fotos / Sonidos

Observ.

tyson_ehlers

Fecha

Septiembre 2, 2021 a las 05:01 TARDE PDT

Descripción

Found in wet mossy ground under Thuja plicata and Pseudotsuga menziesii in a steep creek draw. Compare to: https://www.inaturalist.org/observations/43028599 and https://www.inaturalist.org/observations/52510244.

Fotos / Sonidos

Observ.

lafonge

Fecha

Agosto 29, 2021 a las 03:14 TARDE PDT
Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Observ.

bill_sheehan

Fecha

Febrero 28, 2015

Descripción

The beautiful white fungal filaments sprouted from an oak branch covered with a corticioid fungus. The branch/stick was left in a humid box mixed with six other pieces of wood covered with different corticioid fungi species. Only the oak branch with the orange corticioid fungus sprouted the white filaments. None of the others sprouted any white filaments. Interesting. Were the white filaments growing ON the corticioid fungus and were not part of it?

Fotos / Sonidos

Qué

Nanacate (Schizophyllum commune)

Fecha

Mayo 2022

Lugar

Privado

Descripción

Fotos / Sonidos

Observ.

paul_norwood

Fecha

Marzo 1, 2022 a las 11:04 MAÑANA AKST

Fotos / Sonidos

Observ.

jonathangoff

Fecha

Abril 22, 2022 a las 06:16 TARDE PDT

Descripción

maybe?

Fotos / Sonidos

Qué

Sapo de Espuelas Oriental (Scaphiopus holbrookii)

Observ.

captainjack0000

Fecha

Junio 2019

Fotos / Sonidos

Observ.

luca_hickey

Fecha

Abril 8, 2021 a las 03:56 TARDE PDT

Fotos / Sonidos

Observ.

luca_hickey

Fecha

Junio 27, 2021 a las 04:16 TARDE PDT

Descripción

In puddles umder Thuja plicata

Fotos / Sonidos

Qué

Bejines, Pedos de Lobo Y Parientes (Familia Lycoperdaceae)

Observ.

gemathiesen

Fecha

Abril 2022

Fotos / Sonidos

Observ.

jackjohnsonn

Fecha

Mayo 10, 2022 a las 02:48 TARDE PDT

Descripción

Spermatic odor, growth under young fir trees.

Fotos / Sonidos

Observ.

tyson_ehlers

Fecha

Mayo 4, 2022 a las 05:22 TARDE PDT

Fotos / Sonidos

Observ.

mgkoons

Fecha

Marzo 28, 2022 a las 01:06 TARDE UTC

Fotos / Sonidos

Observ.

natvik

Descripción

Unique old growth habitat - almost flay boggy area.

Fotos / Sonidos

Observ.

lauren_re

Fecha

Enero 16, 2020 a las 05:51 TARDE PST

Descripción

Not glutinous at all, nattering on stipe. Purely white, looks slightly hygrophanous

Fotos / Sonidos

Observ.

lauren_re

Fecha

Noviembre 10, 2020 a las 02:59 TARDE PST

Descripción

Incredibly viscid. Green appearing more as they began to dry at home.

Fotos / Sonidos

Observ.

luca_hickey

Fecha

Diciembre 17, 2020 a las 03:18 TARDE PST

Descripción

@natvik WHAT IS THIIIIS????
Stipe is viscid, with nattering. Gill faces are pinkish red, edges are whitish orange

Fotos / Sonidos

Observ.

luca_hickey

Fecha

Octubre 11, 2020 a las 10:13 MAÑANA PDT

Descripción

Growing near H. miniata but these are all yellow and have decurrent gills. @natvik how did I do on the ID and do you want these specimens?

Fotos / Sonidos

Observ.

natvik

Descripción

Under vine maple in mixed 125yr old 2nd growth.
Exact same spot as previous year - when the DNA suggested a close relationship with this species.
Right at the edge of very active small stream (likely Olympic Mountain snow melt surfacing).
Dry cap and stipe.
Larger than previous observations the biggest at 3.7cm across the cap. Stipe buried and no measurement.

Fotos / Sonidos

Observ.

ssquazzo

Fecha

Marzo 1, 2020 a las 01:56 TARDE PST

Fotos / Sonidos

Observ.

danielwinkler

Fecha

Mayo 22, 2021 a las 03:25 TARDE PDT

Descripción

shady slope, true fir / spruce? forest

Fotos / Sonidos

Observ.

lauren_re

Fecha

Marzo 19, 2020 a las 04:06 MAÑANA HST

Fotos / Sonidos

Observ.

natvik

Fecha

Octubre 2020

Lugar

Privado

Descripción

Collected by Janet Lindgren near Trout Lake in cranberry bogs.
This is another European species that is in the unusual bog habitat.

Fotos / Sonidos

Observ.

mycotrope

Fecha

Mayo 30, 2015 a las 02:28 TARDE PDT

Etiquetas

Fotos / Sonidos

Observ.

dannymi

Fecha

Octubre 10, 2005

Lugar

SR 31, WA (Google, OSM)

Descripción

Drew Parker collection

2500' SR 31, 3 mi S of border

grand fir, hemlock, larch, WRC