Fotos / Sonidos

Observ.

keith_seifert

Fecha

Diciembre 11, 2020 a las 12:52 TARDE EST

Descripción

On a clementine orange.

This in interesting because both the common Penicillium species on oranges are in this image. The faster growing, paler green one covering most of the fruit is P. digitatum. The powdery, more blue colony at the top of the fruit is P. italicum.

Fotos / Sonidos

Observ.

okbirdman

Fecha

Febrero 3, 2024 a las 03:23 TARDE PST

Descripción

Several large groups wintering in a hollowed redwood, as is common for this species (see here). Very cool to see such a wide range of variability among these individuals!

Fotos / Sonidos

Observ.

okbirdman

Fecha

Noviembre 8, 2023 a las 04:54 TARDE PST

Descripción

On Salvia guaranitica (anise-scented sage)

Fotos / Sonidos

Fecha

Diciembre 5, 2020 a las 12:16 TARDE PST

Descripción

Found under the bark of an oak, feeding on white fungus. Covered in mites, presumably hitching a ride, reminiscent of Silphidae mites. 4mm long. Male and female show dimorphic antennae, which is cool.

Fotos / Sonidos

Observ.

kueda

Fecha

Noviembre 9, 2017 a las 11:50 MAÑANA PST

Fotos / Sonidos

Observ.

anudibranchmom

Fecha

Noviembre 26, 2022 a las 12:27 MAÑANA PST

Descripción

Or not? The small, black-headed worm in front of the nudibranch. Could easily be an introduced species @leslieh

Fotos / Sonidos

Observ.

avutardafuriosa

Fecha

Marzo 5, 2021 a las 04:01 TARDE -03

Descripción

El alambre mide 1,2 mm.

Fotos / Sonidos

Observ.

okbirdman

Fecha

Agosto 13, 2023 a las 08:29 MAÑANA PDT

Fotos / Sonidos

Qué

Rana Arborícola Cubana (Osteopilus septentrionalis)

Observ.

ryansikola

Fecha

Abril 22, 2019 a las 05:44 TARDE PDT

Descripción

Walmart plant section herping

Fotos / Sonidos

Observ.

okbirdman

Fecha

Julio 20, 2023 a las 03:26 TARDE PDT

Descripción

Ex broadleaf forget-me-not (Myosotis latifolia)

Fotos / Sonidos

Qué

Estrella Quebradiza Escamosa (Amphipholis squamata)

Observ.

damontighe

Fecha

Mayo 10, 2016 a las 07:30 TARDE PDT

Descripción

The main image is a composite I made (overlay) of the brittle star bioluminescencing in the dark and the image of the brittle star hit with a flash. I had read that Amphipholis squamata had bioluminescence but hadn't seen any images from the California coast, so I brought home a few from the docks at Jack London and took lots of photos, some 30 minutes long at my highest ISO and got nothing. I did some more reading and 200mM KCl can cause a depolarization event leading to extreme bioluminescence so I dissolved a Emergen-C vitamin fizzy drink that has potassium carbonate in it in a minimal amount of water and added that to a few isolated brittle stars and BAM! Light show!

Fotos / Sonidos

Fecha

Septiembre 17, 2023

Descripción

4 photos

Fotos / Sonidos

Observ.

okbirdman

Fecha

Agosto 5, 2023 a las 01:54 TARDE PDT

Fotos / Sonidos

Observ.

jmorton

Fecha

Mayo 6, 2008 a las 07:46 MAÑANA PDT

Fotos / Sonidos

Observ.

okbirdman

Fecha

Abril 21, 2021 a las 07:47 TARDE CDT

Fotos / Sonidos

Observ.

okbirdman

Fecha

Junio 20, 2023 a las 05:11 TARDE PDT

Descripción

On red maple (Acer rubrum)

Fotos / Sonidos

Observ.

ponerinecat

Fecha

Enero 1, 2023 a las 04:05 TARDE PST

Descripción

Undescribed, probably. Not E. armatus due to most legs being 6 segmented. Not E. washingtongensis due to the shape of b2. Not E. spinosus or E. arcuatus due to the shape of st. Not E. californicus due to the length of b3 and the shape of the anal plate. I lack literature for both E. latzeli and unciger, but I beleive both of them are eastern species?

Fotos / Sonidos

Observ.

michaelvoeltz

Fecha

Marzo 7, 2023 a las 08:00 MAÑANA PST

Descripción

Several dozens observed under flat piece of waste asphalt just above wrack line, near edge of mud flats. Tons of amphipods and sea slaters alongside them. Found a number of mouse-eared snails in the mix as well.
Overview of species

Fotos / Sonidos

Qué

Insectos Alados (Subclase Pterygota)

Observ.

okbirdman

Fecha

Junio 6, 2023 a las 11:35 MAÑANA PDT

Descripción

On blue gum eucalyptus leaf. Not sure if larva in an egg or trapped inside water droplet

Fotos / Sonidos

Observ.

catchang

Fecha

Febrero 7, 2018 a las 03:35 TARDE PST

Fotos / Sonidos

Qué

Mojarra Brillosa (Cymatogaster aggregata)

Observ.

okbirdman

Fecha

Julio 18, 2023 a las 07:02 TARDE PDT

Descripción

Terrible pictures. ~3 cm in length, mostly staying in place among shallow algae. Overall impression (tapered head with upturned mouth, rounded caudal fin) looks most to me like Fundulidae. Markings remind me of Lucania goodei (olive above, white below with wide black lateral line, dark base of dorsal fin). I think that salinity is too high in Ballena Bay for this species, and I think this species is uncommon in its introduced region of California, but I don't have any other strong theories.

Fotos / Sonidos

Observ.

ouzel701

Fecha

Julio 1978

Descripción

Singing male

Fotos / Sonidos

Qué

Tortuga de Caparazón Blando de Swinhoe (Rafetus swinhoei)

Observ.

astrapia

Lugar

Vietnam (Google, OSM)

Fotos / Sonidos

Observ.

coonassitsme

Fecha

Julio 1981

Fotos / Sonidos

Observ.

bholland

Fecha

Noviembre 2016

Lugar

Hawaii, US (Google, OSM)

Fotos / Sonidos

Qué

Zambullidor de Atitlán (Podilymbus gigas)

Observ.

valeriosbordoni

Lugar

Guatemala (Google, OSM)

Fotos / Sonidos

Qué

Codorniz Cotuí (Colinus virginianus)

Observ.

flapflapglide

Fecha

Enero 2010

Fotos / Sonidos

Qué

Codorniz Cotuí Sonorense (Colinus virginianus ssp. ridgwayi)

Observ.

chwillbill68

Fecha

Diciembre 2017

Descripción

need some id help.

Fotos / Sonidos

Observ.

kueda

Fecha

Junio 13, 2021 a las 02:55 TARDE PDT

Descripción

Singing from Baccharis at the edge of a Stipa pulchra meadow. Second recording was at point blank range, so that might be some weird distortion.

Fotos / Sonidos

Qué

Liebre Saltarina (Pedetes capensis)

Observ.

alexfrood

Fecha

Agosto 6, 2019 a las 05:53 TARDE CEST

Descripción

First known wild observations and discovery of natural fluorescent in an old world mammal or any mammal outside of North and Central America, images of the Springhare taken in August 2019. Incredible to see it’s orange and pink glow firsthand, especially when it wasn’t expected! Accidental discovery whilst out photographing scorpions under UV light

Shot using a Nikon D850 Handheld with a Nitecore Chameleon C6 ( 365nm ) torch.

For anyone interested in February 2020 a Scientific journal was released by a American research group ( no relation to me ) about this UV trait and science behind it from research in museum & zoo specimens in the US.

There are a few more images, but you might be able to imagine photographing a rather skittish nocturnal creature on foot with a UV torch in one hand and a large DSLR in the other during a unexpected encounter whilst also trying to expose a camera correctly for UV light isn’t the easiest thing to do the split second.

Fotos / Sonidos

Observ.

okbirdman

Fecha

Junio 30, 2023 a las 10:42 TARDE PDT

Descripción

On Rosa sp.

According to this observation, this is part of a known group of Diplolepis that are not quite consistent with D. polita. I will keep this at genus level until molecular work clarifies the relationship, unless it would make more sense to assign this to D. polita in order to atlas this group for subsequent taxon swaps

Fotos / Sonidos

Observ.

isawe

Fecha

Enero 2018

Descripción

1000 meters altitude

Fotos / Sonidos

Observ.

kristofz

Fecha

Diciembre 24, 2017 a las 09:48 MAÑANA EST

Descripción

Identification as E. schoenherri confirmed by Alexander Riedel (State Museum of Natural History Karlsruhe). The Arfak population represents subspecies petiti (see photo in www.papua-insects.nl/insect%20orders/Coleoptera/Curculionoidea/Curculionidae/Eupholus%20schoenherri%20petiti.jpg). Habitat: understory of primary montane forest at 1800 m elev.

Fotos / Sonidos

Fecha

Mayo 27, 2023 a las 09:45 MAÑANA EDT

Descripción

I highly recommend taking a look at this fascinating article on the remarkable rediscovery of Scyphacella arenicola by Dr. Pallieter De Smedt, featured on the Smithsonian's Website!

https://naturalhistory.si.edu/research/invertebrate-zoology/news-and-highlights/isopod-rediscovery

This is the second beach, out of four, with the species.

Fotos / Sonidos

Observ.

johnsankey

Fecha

Agosto 15, 2017

Descripción

on Sonchus arvensis, length 1.6 mm

Fotos / Sonidos

Observ.

pogon

Fecha

Febrero 20, 2021 a las 10:23 MAÑANA PST

Descripción

There is a major die-off of Eucalyptus on Albany Hill. Isolating fungi from the leaf lesions yielded this culture, which is a known pathogen elsewhere. It grows as sort of a yeasty black culture.

ITS sequence: AAGGATCATTAAAGAGTAAGGGGCTAAACACCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTTGTTGCTTTGGCGGGACCGCTCGGTTCCGAGCCGCCAGGCCCCCTCACCGGGGTCGCGGCGAGTTCCCGCCAGAGTTAAACCAAACTCTTGTTATATAAACCGGTCGTCTGAGTAAAAATTTTGAATTAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATTGCTTGGTATTGGGCTCACCGTCCCCGCCAGTCGGGGGCGTGCCTCAAACACCTCGGCGGAGCCTCACCGGCTTTGGGCGTAGTAGATTTTCTAATAACGTCCTTTAACGGAGAGTGCTTCTTTGCCGATTGAAGACTTACACTTCTTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

Fotos / Sonidos

Observ.

coreyjlange

Fecha

Agosto 7, 2020 a las 07:32 MAÑANA PDT

Descripción

It took me some sleuthing to figure out where the actual type locality for this species was located. This species was described by Hershler (1995), and the type locality information provided was:

"Type locality: Unnamed spring about 4.8 km west-southwest of Hallelujah Junction, Long Valley, Lassen County, California, T. 22 N, R. 17 E, SW 1/4 sec. 9 (Figure 4E). Holotype, USNM 860642 (Figure 5E); paratypes, USNM 858262, collected by R. Hershler and D. Sada, 3 August 1990. Snails were commonly found on stones and in watercress of this large spring, which was situated adjacent to a residence and had been recently excavated."

"Remarks: This species is known only from the type locality in the southern end of the Honey Lake basin (Figure 6)."

The township and range described in the paper was wrong, as no springs matching the description provided were located there. However, using Google Earth I was able to identify a few possible spring candidates that could be the type locality approximately 4.8 km southwest of Hallelujah Junction. All of the springs that I thought could have been the type locality were located on private land owned by the City of Santa Clara. I obtained written permission to visit the property and quickly located the type locality spring behind the abandoned house on the property. Springsnails were not overly common in the spring, and the spring had been previously developed in the past. There was also evidence of use of the spring by cattle. I've attached two photos of the spring to this observation. I checked nearby springs to see if I could find springsnails, but I found no Pyrgulopsis in any other nearby springs.

The correct Township and Range for this spring and type locality would be: T. 22 N, R. 17 E, SE 1/4 sec. 17

https://repository.si.edu/bitstream/handle/10088/11299/iz_Hershler1995.pdf

Fotos / Sonidos

Observ.

arnel

Fecha

Marzo 31, 2018 a las 09:19 MAÑANA PDT

Descripción

Alameda Salt Marsh Song Sparrow (Melospiza melodia ssp. pusillula), photographed at Alviso Marsh in Alviso Marina County Park. Identiified as such from the bird's very heavy, dark streaking and its location in one of the South Bay's salt marshes.

Alviso Marina County Park is located in the Alviso district of San Jose, CA, in northern Santa Clara County. It is an excellent place to look for Alameda Salt Marsh Song Sparrow, as well as other salt marsh specialists.

References:
1) Chan, Yvonne, and Spautz, Hildie, "Alamda Salt Marsh Song Sparrow." California Bird Species of Special Concern, 2008. Pp. 419 - 424.
2) Nur, Nadav, et. al., "Tidal Marsh Song Sparrows of San Francisco Bay," 2002. Pp. 1-4
3) Rising, James D., The Sparrows of the United States and Canada. Academic Press, 1996, pp. 190 - 195.

Fotos / Sonidos

Qué

Gorrión Cola Blanca (Pooecetes gramineus)

Observ.

okbirdman

Fecha

Abril 24, 2022 a las 12:34 TARDE PDT

Fotos / Sonidos

Observ.

shaun-lee

Fecha

Febrero 21, 2016

Descripción

Bioluminescent Limpet

Fotos / Sonidos

Observ.

graysquirrel

Fecha

Marzo 28, 2022 a las 03:18 TARDE PDT

Descripción

Host is Claytonia perfoliata

Fotos / Sonidos

Observ.

patrickhoffman

Fecha

Julio 16, 2010

Descripción

The first photo is the cercaria stage shed from a planorbid snail collected from a pond at Pleasanton Ridge Regional Park. The second photo shows an infected Pseudacris sierra from the same pond.

Fotos / Sonidos

Observ.

okbirdman

Fecha

Marzo 21, 2022 a las 01:15 TARDE PDT

Fotos / Sonidos

Fecha

Febrero 2022

Descripción

This is a Common Black Hawk x California Red-shouldered Hawk. Not sure how to get this as the ID.
Known offspring of the Common Blackhawk that lived here for 15 years.

Etiquetas

Fotos / Sonidos

Observ.

okbirdman

Fecha

Abril 16, 2021 a las 12:11 TARDE CDT

Descripción

On Quercus stellata. Not positive gall wasp but best place to start

Fotos / Sonidos

Observ.

okbirdman

Fecha

Abril 4, 2021 a las 04:04 TARDE CDT

Fotos / Sonidos

Observ.

tshahan

Fecha

Junio 2010

Fotos / Sonidos

Qué

Salamandra Delgada de California (Batrachoseps attenuatus)

Observ.

damontighe

Fecha

Febrero 2021

Descripción

Leucistic? The pigment in the ocular orbitals is making me hesitate on saying albino

Fotos / Sonidos

Qué

Tordo Sargento (Agelaius phoeniceus)

Observ.

greglasley

Fecha

Junio 1, 1989

Descripción

Red-winged Blackbird
near Stewardson, Illinois
1 June 1989

I'm posting this record just for the general interest of a Red-winged Blackbird with one white wing. Whether a partial albino, or a partial leucistic bird, I'm not sure. A local farmer told my wife and me that this bird had been on his farm for three summers. The bird left in the fall with the other Red-wingeds and came back in the spring. I watched it for about 30 minutes. It vocalized like any other Red-winged BB and interacted with other Red-wingeds normally. It was pretty flashy to see in flight, however. Three shots posted. These images scanned from old color slides.

Fotos / Sonidos

Qué

Marta Pescadora (Pekania pennanti)

Observ.

devonted

Fecha

Julio 29, 2019 a las 08:42 TARDE EDT

Fotos / Sonidos

Observ.

okbirdman

Fecha

Febrero 6, 2021 a las 10:16 MAÑANA CST

Fotos / Sonidos

Qué

Zorra Gris (Urocyon cinereoargenteus)

Observ.

ribitzki49

Fecha

Enero 5, 2021 a las 07:32 TARDE CST

Descripción

home

Fotos / Sonidos

Qué

Tordo Cabeza Café (Molothrus ater)

Observ.

lwbadger

Fecha

Junio 3, 2018 a las 12:22 TARDE CDT

Fotos / Sonidos

Qué

Tiburón Blanco (Carcharodon carcharias)

Observ.

sharksteward

Fecha

Agosto 2020

Descripción

Picture Gary Emich

Fotos / Sonidos

Observ.

simono

Fecha

Julio 1, 2018 a las 10:54 TARDE AWST

Descripción

In the peak of the top end dry season. A mantis crashed into the spotlight of my parked vehicle and fell on the ground, stunned. The katydid immediately arrived and began eating it. This is a dried up creek bed and the nearby vegetation is extremely dry - perhaps the katydid desperately needed the moisture. Bowerbird.org.au sighting being moved to iNaturalist as the former website is shutting down.

Fotos / Sonidos

Observ.

kevin193

Fecha

Junio 5, 2020 a las 07:06 MAÑANA UTC

Fotos / Sonidos

Qué

Quilico (Falco sparverius)

Observ.

wingnut

Fecha

Octubre 26, 2018 a las 05:51 MAÑANA EDT

Descripción

With mantis as prey!

Mollusks

Fotos / Sonidos

Qué

Caracoles, Almejas Y Pulpos (Filo Mollusca)

Observ.

cymbalaria

Fecha

Julio 16, 2018 a las 08:38 MAÑANA CEST

Fotos / Sonidos

Qué

Musarañas (Familia Soricidae)

Observ.

colin25

Fecha

Diciembre 12, 2020 a las 04:38 TARDE SAST

Fotos / Sonidos

Observ.

lukearmstrong

Fecha

Noviembre 23, 2011 a las 09:53 MAÑANA EST

Fotos / Sonidos

Observ.

stijn_de_win

Fecha

Abril 13, 2008 a las 05:17 MAÑANA +08

Descripción

At arrow

Etiquetas

Fotos / Sonidos

Observ.

okbirdman

Fecha

Septiembre 19, 2020 a las 04:32 TARDE CDT

Descripción

I'm pretty sure a hybrid but I'm not positive which two. I believe all four are now in this waterway. I was thinking M. chrysops x americana or M. chrysops x mississippiensis but I haven't been able to find any photos of these crosses for comparison.