Cap had a very fibrous texture, the pore surface slowly stained blue and was the only place on the mushroom that changed color. Found growing at the base of Eastern White Pine.
New species, det. Brandon Matheny T. glaucescens = new name. — iNat won’t accept name
Deer Lick old road, Wildacres property
Growing in open areas under oaks.
—
Additional sequences:
nrITS: GenBank ON554799.
1) Full-length nrITS sequence from a reverse read sans the adjoining SSU &LSU fragments
2) DNA sequencing by Molecular Solutions, LLC (Matt Gordon)
3) Sequence processing by IGS
Full-length nrITS sequence -- MO410289/Boletaceae sp.:
TCGAAATAATAAGTGGGAGGCTCGTTGCTGGCCAGTTCAGTCAGGCATGTGCACGTCTTCCAGCAAAAAATACACCCTTGTGCACCTATTGTAGACCCCTCGCAAGAGGGATCTATGTTTTCACATCACACCCATCGTATGTCTATAGAATGTCTATCCATGGCCTTACCGAACGGAGGGTGATTCCTCTCTAACAGGGAGGGCTTGAAATAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGACGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTATCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGGTTAATTTATCAACCATGTCTTTTGGTAGGCATCGGCTTGGAGTTGGGGGCTTTGCTGGTCTTTCGTGATCAGCTCTCCTGAAATGCATTAGTGAAGTGTCTTCGTTGGCATGGACGTGATAATGGATCGTCCTGACTGCTTTGGAAGATGCTTTGCTTCGAACGCGACGTAGTTATTAGGAAGGACGAGCGTGTAGCTACTCGGCCATGGCTTAATTAGCATCGGACGAACGCATCAGCTATTAGTCTGTGTGAACGGGCTGAGGTCAACGAGCTTTAAACTACTAGTCTGAACGAACGCACGTCAAACGTGGACATGGTGGACATAGTTATTAGGATAGACGAACGTGTGGCTGCTAGTCTGAACGGAACGCTACGGTAGTTATTAGGATGGACGAACGTGTGGCGAGTTGGCCATGGGCTTATTAGCATCGGACGAACGCTAATCAATTAGCTATTAGTCTGGGTGAACGGCTGGGGTCGACAAGCTTTAAACTACTAGTCTGAACGAACGCTACCATAGTCATTAGGACGGACGAAGGTGACACTACTAGTCTGACCGAACGCACGTCGAACCTACACATCTGAAAC
—
Originally posted to Mushroom Observer on May 24, 2020.
Image #7: Tube-like pores
Image #8: Spores (h20)
—
Originally posted to Mushroom Observer on Sep. 1, 2022.
Found by Sarah Prentice at the Mycological Society of America 2022 foray. Growing on a dead, standing Pinus palustris. Fruiting through bore holes. Cap smooth, Staining blue in context above pores. Odor not distinctive.
—
Originally posted to Mushroom Observer on Aug. 23, 2022.
This is the sixth time I have seen it this week (in four different states)
This is the sixth time I have seen it this week (in four different states)
No reaction with KOH or ammonia on cap, cap flesh stains light orange with KOH, mild taste, no strong odor
https://mushroomobserver.org/333089?q=hXS3 has results from DNA analysis
Quercus laurifolia and Pinus taeda habitat. Sandy soil
Mild taste
Mild taste. 99.29% match to trustworthy sequence
In sandy soil
Quercus laurifolia and Pinus taeda habitat. Sandy soil
Quercus laurifolia and Pinus taeda habitat. Sandy soil
Mild taste
Mild taste. 99.29% match to trustworthy sequence
In sandy soil