clusters with Ben Woo's collections of R. mustelina which closely match a trusted sequence from the type area and the UNITE concept.
11:28 north arb
11:40 north arb
3200+ feet, cedar, fir, oregon grape, salal, forest duff
Small waxcap on very rotten wood in old second growth forest.
Cap moist - not viscid, stipe not viscid.
Orange cap, stipe and gills.
Bog area next to open water.
Old growth habitat
Stipe dried bright red
Growing in bare ground of street tree planting in grassy parking strip. Irrigated. Trees are flowering pears.
On moss in white cedar woods. Moist cap an stem. Stem hollow and orange. Cap bright red. Single. Gills attached orange
Greenish tint to cap, ring around edge of cap, center dot, crystals on cap visible through hand lens, sandy soil, solid stipe, faint vein lines on stipe, KOH yellow with red ringed edge
ITS barcoding showed this to be H. phaeococcinea, not H. miniata or other little red waxcaps.
ITS barcode: AGGATCATTACTGAAAAAATATTTGAGGATGTTGCTGGCATTTGCACGTGCACTCCTTGAACCATTTCTGACCCTTTTCACACCATGTGCACCTGTTGTAGGTTTTTTTGGTTTCACAACCAAAACCTATGTTTGCTCTTTTTAATAACACCATTGAATGTATCTGAATGCATGGTTGGACAAAAAGGGCCCTCCGGCTCTGGATGTCAAAAAATAAAACACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATTGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGAGGCATGCCTGTTTGAGTGTTATTGAACCCCTCTCAACCCTTGGCCCTTGAGCGGTCGAGGTTTGGATTTGGAGAGTGCCGGCCAAGTTTGGCTCCTCTAAAATGCATTAGCGAGCGACGCTTTCATGCGACTGCTTTGGCATTGATAGACCTGTCTATGCCTAGGTGCCGCTGGCGGGTTTGCTTACGAGTGGTCTCCTTTTGGGGGACAAATGCAACCTCTTAACAATCACCTCCAATCAGGTA
Brilliant gills! Growing under sword fern in mixed 125 year old 2nd growth forest.
located inside rotting trunk unknown tree, moss, woody debri
located inside rotting trunk unknown tree, moss, woody debri
A puffball without "puff"?
Watched, it matures and splits in half down the middle - so doesn't really seem like a puff ball.
Three of them on ground in very mature second growth forest.
Small waxcap on very rotten wood in old second growth forest.
Cap moist - not viscid, stipe not viscid.
Orange cap, stipe and gills.