Fecha añadida
29 jun. 2022
12:06 PM PDT
Fecha añadida
13 ago. 2011
12:05 AM EDT
Fecha añadida
08 mar. 2022
03:35 PM PST
Fecha añadida
04 may. 2022
03:18 PM AEST
Fecha añadida
20 may. 2022
07:16 PM HST
Lugar
Privado
Fecha añadida
10 may. 2022
03:52 PM PDT
Descripción
Contra Costa County , California . Known site , exact location not shown .
Fecha añadida
20 dic. 2019
09:41 PM PST
Fecha añadida
06 nov. 2020
09:10 AM PST
Descripción
On cantharellus cascadensis. Located by Melissa Johnson-Ravare. T21S R5E Sec 36 NW4 3500 ft elevation
Fecha añadida
29 mar. 2022
09:27 PM IDT
Fecha añadida
27 sep. 2020
08:27 PM PDT
Fecha añadida
09 dic. 2021
11:26 AM PST
Fecha añadida
26 mar. 2022
02:54 AM UTC
Fecha añadida
23 mar. 2022
05:09 PM EDT
Descripción
Additional photos and close ups of main individual.
Fecha añadida
23 mar. 2022
10:44 AM PDT
Fecha añadida
23 mar. 2022
10:21 AM PDT
Fecha añadida
23 mar. 2022
12:21 PM CDT
Fecha añadida
13 ene. 2022
01:36 PM CET
Fecha añadida
10 mar. 2022
05:32 PM CST
Fecha añadida
16 ene. 2022
04:09 AM UTC
Descripción
SOMA foray
Found amongst Umbellularia californica and Psuedotsuga menziesii with scattered Quercus agrifolia nearby
Fecha añadida
23 ene. 2019
09:14 AM UTC
Fecha añadida
02 feb. 2022
01:15 AM UTC
Fecha añadida
20 feb. 2022
01:06 AM UTC
Fecha añadida
02 dic. 2012
03:30 AM HST
Descripción
Bulbous Mushroom
Ball shaped cap when young and purple-pinkish colour. Becoming flat and caramel brown, Bulbous clavate stem, creamy lamellae,cap diameter 4-5,5cm, height 5cm, bulb diameter 3-4,5cm, growing under Tipiana
Fecha añadida
11 feb. 2019
07:47 AM PST
Fecha añadida
04 mar. 2022
06:58 PM PST
Fecha añadida
04 mar. 2022
05:41 PM GMT
Fecha añadida
07 nov. 2018
10:24 AM PST
Fecha añadida
06 ene. 2016
11:04 PM MST
Fecha añadida
22 mar. 2019
02:17 PM PDT
Descripción
Growing on ericameria stem, strongly farinaceous odor.
Fecha añadida
24 feb. 2022
05:58 AM PST
Fecha añadida
21 feb. 2022
01:52 PM PST
Fecha añadida
24 jul. 2019
08:03 PM EDT
Descripción
red oak, hemlock, yellow birch
Fecha añadida
29 sep. 2020
10:05 PM PDT
Fecha añadida
15 nov. 2020
09:06 PM PST
Fecha añadida
25 ago. 2021
03:08 PM UTC
Descripción
Growing on decomposing White Birch
Fecha añadida
21 may. 2020
08:35 PM UTC
Fecha añadida
17 nov. 2020
08:52 PM PST
Descripción
I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.
Sequenced on 3/3/21 by FunDis:
Nucleotide Sequence
CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT
Fecha añadida
24 oct. 2020
12:13 PM PDT
Fecha añadida
17 feb. 2022
07:04 PM CST
Descripción
On the underside of Quercus pagoda leaf. A few alate individuals present.
White coloring nearby is probably the mycelial mat formed by Erysiphe abbreviata, often found hypophyllous on Q. pagoda .
Fecha añadida
02 jun. 2020
01:52 PM PDT
Fecha añadida
19 dic. 2020
09:28 AM EST
Descripción
Echinodontium ballouii wasn't seen for 100 years until Larry Millman found it in an Atlantic White Cedar swamp. Larry took me to the site, (which I can't say where it is) and we found about a dozen of these again 4 years after the first visit.
Fecha añadida
25 mar. 2021
10:24 PM EDT
Descripción
Leucopaxillus gracillimus.0182.7.28.13.dwb/alachua co. florida
rather uncommon
syn. Clitocybe rappiana
Fecha añadida
05 mar. 2017
08:41 PM PST
Fecha añadida
18 abr. 2019
03:49 PM PDT
Descripción
Tiny 1-mm springtail swept from grasses and collected temporarily for photomicrographs.
Fecha añadida
10 feb. 2022
03:34 PM CST
Fecha añadida
10 feb. 2022
03:34 PM CST
Fecha añadida
10 feb. 2022
03:34 PM CST
Fecha añadida
07 feb. 2022
06:25 PM PST
Fecha añadida
28 jul. 2021
01:40 AM UTC
Fecha añadida
05 feb. 2022
07:21 PM HST
Descripción
I was thrilled when @graysquirrel found these as we were poking around the woods together! Such a beautiful species!
Fecha añadida
31 ene. 2022
03:54 AM PST
Descripción
On Toyon berries, Heteromeles arbutifolia.
Fecha añadida
02 dic. 2021
04:25 PM PST
Fecha añadida
30 ene. 2022
07:46 PM PST
Fecha añadida
27 ene. 2021
05:58 AM EST
Fecha añadida
20 oct. 2021
05:34 AM +06
Fecha añadida
13 dic. 2021
06:08 AM UTC
Fecha añadida
22 ene. 2022
01:51 AM UTC
Fecha añadida
30 jul. 2021
01:53 AM UTC
Fecha añadida
20 may. 2018
11:36 PM PDT
Descripción
Turned him up cleaning the glass. This is the biggest sculpin I've ever seen in the creek, though the camera lens wants to make my fingers look bigger than they are relative to the fish.
Fecha añadida
09 may. 2021
11:55 PM PDT
Fecha añadida
20 ene. 2019
11:27 PM PST
Fecha añadida
20 ene. 2022
05:07 AM PST
Fecha añadida
03 jun. 2019
04:09 PM PDT
Fecha añadida
12 feb. 2021
03:52 PM PST
Descripción
Found several under rocks and logs on a rocky, grassy hillside, maybe 1-2 mm long, fairly active. I think these should be called candy cane mites or Christmas mites.
Fecha añadida
04 jul. 2020
10:28 PM EDT
Descripción
In beached driftwood, third photo is young found brooding in the gills of larger individuals
Fecha añadida
18 ene. 2022
06:44 PM PST
Descripción
Chartreuse colored cap, bulb, and mycelial threads; reddish brown discolorations on cap; olivaceus-black KOH rxn on cap
Fecha añadida
18 ene. 2022
06:38 PM PST
Fecha añadida
16 sep. 2021
06:46 PM PDT
Descripción
Garden Spot East Anacapa ~25ft
Fecha añadida
31 oct. 2021
02:36 PM UTC
Fecha añadida
01 dic. 2021
08:40 AM PST
Fecha añadida
12 dic. 2021
08:54 PM EST
Descripción
On abandoned fire wood. Hidden against ground and adding and growing on debris. 4 pores per mm.
Bruising pinkish. Spores: 3.7-4 x 4.9-5.4 with drop. Basidia: up to 37 x 7.4 um with four sterigmata. Lots of cystidia with round and pointy ends. Pine Barrens.
Fecha añadida
27 jun. 2019
03:54 PM PDT
Descripción
Not an insect! Springtails are a different Class. This particular springtail is a golden snowflea.
Fecha añadida
10 ene. 2017
05:10 PM PST
Descripción
The orange ones. Our ID is based on comparison to pictures on Bugguide.net. We are hoping for confirmation from them.
Fecha añadida
17 feb. 2017
07:48 PM PST
Fecha añadida
04 mar. 2017
07:17 PM PST
Fecha añadida
04 may. 2021
03:31 PM PDT
Descripción
Podocerus cristatus amphipod at Santa Cruz Island, CA. Depth 60' / 20M. Water temp 50 degrees F
Fecha añadida
22 oct. 2018
10:50 AM PDT
Descripción
Dive site Emerald Cove, max depth 61ft/19m.
Decently large (~4" diameter) solitary anemone.
Fecha añadida
19 nov. 2021
12:18 PM PST
Fecha añadida
10 ene. 2022
03:35 PM UTC
Descripción
Parasitic isopod on the tail of a white surfperch
Fecha añadida
21 dic. 2021
11:47 AM PST
Fecha añadida
30 ene. 2021
10:41 AM PST
Fecha añadida
18 sep. 2015
03:56 PM PDT
Descripción
27mm length. Second photo is close-up of rhinophore. Specimen at CASIZ 208937.
Fecha añadida
01 jun. 2016
08:46 PM PDT
Fecha añadida
07 ene. 2022
06:34 PM PST
Descripción
inverts from RV Yellowfin cruise_Dr. Kimo Morris' marine biology class
Fecha añadida
08 mar. 2019
06:15 AM PST
Fecha añadida
14 mar. 2021
12:56 PM PDT
Fecha añadida
15 abr. 2018
10:02 PM PDT
Fecha añadida
13 dic. 2019
05:14 PM PST
Fecha añadida
22 mar. 2021
03:42 PM HST
Fecha añadida
05 ene. 2022
08:01 PM PST
Fecha añadida
05 ene. 2022
08:04 PM PST
Fecha añadida
04 ene. 2022
12:59 PM PST
Descripción
There were hundreds of these fellows in a small, seasonal pond (last photo).
Fecha añadida
02 ene. 2022
11:17 AM CST
Descripción
Little Monardella (Monardella nana), eastern San Diego County, California
Fecha añadida
26 sep. 2019
01:49 AM UTC
Descripción
Host mushroom chanterelle, found in the coast range of Oregon. Research and suggestions led to entoloma parasiticum as the most likely candidate.
Fecha añadida
08 ene. 2021
05:33 AM UTC
Fecha añadida
01 ago. 2021
01:41 AM CDT
Fecha añadida
21 dic. 2021
06:26 PM PST
Fecha añadida
02 sep. 2021
11:25 PM BST
Descripción
Right hand bird in photos with Common Snipe.
Fecha añadida
08 dic. 2021
12:41 PM PST
Descripción
Low tide. Shot from above and below water.
Fecha añadida
15 dic. 2021
03:45 PM HST